ID: 1048330951

View in Genome Browser
Species Human (GRCh38)
Location 8:133470586-133470608
Sequence CTGAGCTCCTTGGGAAGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048330944_1048330951 -7 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330951 8:133470586-133470608 CTGAGCTCCTTGGGAAGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048330951 Original CRISPR CTGAGCTCCTTGGGAAGCAC GGG Intronic
No off target data available for this crispr