ID: 1048333039

View in Genome Browser
Species Human (GRCh38)
Location 8:133484127-133484149
Sequence TCTGTTCACCACCCAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048333039_1048333043 -9 Left 1048333039 8:133484127-133484149 CCATTCACTGGGTGGTGAACAGA 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1048333043 8:133484141-133484163 GTGAACAGAATATGGGTATTGGG No data
1048333039_1048333045 -7 Left 1048333039 8:133484127-133484149 CCATTCACTGGGTGGTGAACAGA 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1048333045 8:133484143-133484165 GAACAGAATATGGGTATTGGGGG No data
1048333039_1048333046 7 Left 1048333039 8:133484127-133484149 CCATTCACTGGGTGGTGAACAGA 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1048333046 8:133484157-133484179 TATTGGGGGTCAGCCAGATCTGG No data
1048333039_1048333047 8 Left 1048333039 8:133484127-133484149 CCATTCACTGGGTGGTGAACAGA 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1048333047 8:133484158-133484180 ATTGGGGGTCAGCCAGATCTGGG No data
1048333039_1048333042 -10 Left 1048333039 8:133484127-133484149 CCATTCACTGGGTGGTGAACAGA 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1048333042 8:133484140-133484162 GGTGAACAGAATATGGGTATTGG No data
1048333039_1048333044 -8 Left 1048333039 8:133484127-133484149 CCATTCACTGGGTGGTGAACAGA 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1048333044 8:133484142-133484164 TGAACAGAATATGGGTATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048333039 Original CRISPR TCTGTTCACCACCCAGTGAA TGG (reversed) Intronic
903098201 1:21001106-21001128 TCTGTTCATCAGCCAATAAATGG + Intronic
904429359 1:30451941-30451963 TGTGTCCATCACCCAGTGAAGGG - Intergenic
908072906 1:60483237-60483259 TATGTTCAGCACCCAGTATAGGG + Intergenic
909700716 1:78519448-78519470 TCTGGTAAGCATCCAGTGAAAGG + Intronic
910810983 1:91236239-91236261 TCTGTTCATCACTCAGGGGAAGG - Intergenic
911628352 1:100153153-100153175 TGTCTTCACCACCCAGTACAAGG + Intronic
916648335 1:166811443-166811465 TCTGTTCACAACCTACAGAATGG - Intergenic
919749524 1:201028311-201028333 TCTGCTAACCACTCAGTGACGGG + Intergenic
924919904 1:248617941-248617963 AGTGTTTACCACTCAGTGAAGGG + Intergenic
1063909755 10:10817711-10817733 ACTGTTCATCAGCCAATGAATGG - Intergenic
1064419645 10:15179766-15179788 ACTGTTGTCCACCCAGAGAAAGG - Intergenic
1068301544 10:55148503-55148525 TCAGTTTACAACCCAGGGAATGG + Intronic
1068585848 10:58797509-58797531 TCTGTTCAGGTCCCAGTGGAAGG - Intronic
1069241873 10:66151657-66151679 TCTGTTCTTCAGCCACTGAAGGG + Intronic
1072603093 10:96950288-96950310 GCTGTTCACCACACAGGAAAAGG - Intronic
1074912058 10:117920597-117920619 TCTGCTCACCACCCCGTGACTGG + Intergenic
1074972401 10:118550017-118550039 TCTCTTCTCCACCCACTGACTGG + Intergenic
1083593997 11:63910409-63910431 TCTGTCCCCCACCCTGTGGAGGG - Exonic
1084519858 11:69656454-69656476 TCTGTACATCCCCCAGTGATGGG + Intronic
1085710964 11:78828986-78829008 TCTGCTCTCCACCCAGTGGGAGG + Intronic
1088603914 11:111511247-111511269 TCTGTACACCCCATAGTGAAGGG - Intronic
1089108213 11:116032822-116032844 ATGGTTCACCACCGAGTGAATGG - Intergenic
1090161285 11:124498302-124498324 TCAGGTCACCAACCAGTGTAGGG - Intergenic
1090265112 11:125348708-125348730 TTTGTTCACTGTCCAGTGAATGG - Intronic
1094214441 12:27925502-27925524 TCTATTCAACACTCAGTAAATGG + Intergenic
1094471650 12:30807189-30807211 TCTGCTCAGCACCAAGTGTACGG + Intergenic
1097956313 12:65489156-65489178 TCTGTTCAGGACCCAGGAAATGG + Intergenic
1100576959 12:95901009-95901031 TCTGTTCTCCATACAGTGATAGG - Intronic
1101337923 12:103813204-103813226 TCTGTTCACTACCCCCTAAAAGG - Intronic
1101404335 12:104414701-104414723 TGTTTAAACCACCCAGTGAATGG + Intergenic
1102661681 12:114534372-114534394 TGTGCTCACTACCCAGTGAGGGG + Intergenic
1102666061 12:114573959-114573981 TGTGCTCACTACCCAGTGAGGGG - Intergenic
1104787554 12:131459405-131459427 TTTGTTCACCCCACACTGAAGGG + Intergenic
1104873507 12:132017073-132017095 GCGGCTTACCACCCAGTGAAGGG - Intronic
1107478651 13:40766213-40766235 TCTGTACACAATCCAGAGAAAGG - Intronic
1107795806 13:44050373-44050395 TCAGTTCAACACACAGTGTAAGG - Intergenic
1108621488 13:52189088-52189110 TCTGCACACAATCCAGTGAAAGG - Intergenic
1108665158 13:52622471-52622493 TCTGTACACAATCCAGTGAAAGG + Intergenic
1113911467 13:113843372-113843394 GCTCGTCACCACCCAGGGAAAGG - Intronic
1115465072 14:33706290-33706312 TGTGGTGAACACCCAGTGAATGG - Intronic
1116575006 14:46562984-46563006 TATGTCCACCAGCAAGTGAATGG + Intergenic
1117982726 14:61357930-61357952 TCTGGTCACCAGGCAGTGCAAGG - Intronic
1118265178 14:64288058-64288080 CCTGTTCACCACCCAGGATATGG - Intronic
1120455792 14:84728926-84728948 TCTGTTGACCACCCAGTCTATGG + Intergenic
1121736887 14:96225003-96225025 TTTGTGCCACACCCAGTGAAGGG + Intronic
1126785651 15:52176148-52176170 TCTGTTCACTCCCCAGAGCAGGG - Intronic
1127174188 15:56336562-56336584 TTTATACACCACCCAGTGTATGG + Intronic
1128650035 15:69404366-69404388 TCCCTTCTCCACCTAGTGAAGGG + Exonic
1129559701 15:76553141-76553163 TATGTGCACCATCCAGGGAAGGG - Intronic
1130007203 15:80111257-80111279 TATGTTCATCACCCAATGAAGGG - Intronic
1130206261 15:81878603-81878625 TCAGATGCCCACCCAGTGAATGG + Intergenic
1131047266 15:89324042-89324064 TCTGTATTCCACCCAGGGAAGGG - Intronic
1131419108 15:92288748-92288770 ACACTACACCACCCAGTGAAGGG + Intergenic
1135729778 16:24884190-24884212 TCTGCTCTCCACACTGTGAACGG + Intronic
1136918135 16:34232965-34232987 TGTGTTCACCACCCACAGAGTGG + Intergenic
1140842526 16:78853636-78853658 CCTCTTCTCCACCCAGGGAAAGG - Intronic
1141888714 16:86911674-86911696 TCAGATCACCACTCAGTGAAAGG - Intergenic
1143959424 17:10702743-10702765 TCACTTCCCCAGCCAGTGAATGG + Intronic
1149776356 17:59360622-59360644 TCTGTTGACCACCCAGGAAGGGG + Intronic
1151765445 17:76131198-76131220 CCTGTTCCCCACCCCCTGAAGGG - Intergenic
1153831315 18:8925935-8925957 TCTGTTCCTCACCCATTGCAAGG + Intergenic
1154295033 18:13140165-13140187 CCTGTTCACCAACCACTGGAAGG - Intergenic
1155287412 18:24304888-24304910 CCTGCTCTCCACCAAGTGAATGG - Intronic
1155393178 18:25358990-25359012 TGTATTCACCTCCCAGGGAAGGG - Intergenic
1159921840 18:74233522-74233544 TCTGTTTAAAACCCACTGAATGG - Intergenic
1160170910 18:76553562-76553584 AATGTTCATCACCCAGTGAATGG + Intergenic
1160691817 19:463815-463837 CCTGTTTCCCACACAGTGAACGG - Exonic
1164559344 19:29278028-29278050 TCTGTTCTCCACCCAGTCAATGG - Intergenic
1165142262 19:33706856-33706878 CCTTTTCACTCCCCAGTGAAGGG - Intronic
1166031970 19:40138113-40138135 TCTGTTCTCCACAAAGAGAAGGG + Intergenic
1166411315 19:42557185-42557207 TCTGTGCACTACCCTGTTAAGGG + Intronic
1167211128 19:48134810-48134832 TCTGCTCAGCACCCAGTGGGGGG + Intronic
925832753 2:7912217-7912239 TCTGTTGTCCACCCAGTTTATGG - Intergenic
930721406 2:54641686-54641708 GCTATTCACCACACAGGGAATGG - Intronic
932622316 2:73272100-73272122 TCTGTTCACCAACCTGTGAGTGG - Intronic
934625555 2:95847439-95847461 TCAGTTACCCACCCAGTGCAGGG + Intronic
934808017 2:97253879-97253901 TCAGTTACCCACCCAGTGCAGGG - Intronic
934829493 2:97503308-97503330 TCAGTTACCCACCCAGTGCAGGG + Intronic
939144970 2:138402490-138402512 ACTGTCCATCAACCAGTGAATGG + Intergenic
939640987 2:144639600-144639622 TCTGTTCATTCCCCAGTTAAAGG + Intergenic
941912903 2:170783057-170783079 TCTGTCACCCACCCAGTGCAGGG - Intergenic
943111460 2:183611314-183611336 GCTGATCACCATCCAGGGAAGGG + Intergenic
944471977 2:200063479-200063501 TCTGTTTACCACCAGGTGACAGG - Intergenic
945810381 2:214542591-214542613 ACTGTCCACCACGCAGTGACGGG + Intronic
947012162 2:225578323-225578345 TCTCTTCACCAAGCAGGGAAGGG + Intronic
1174253912 20:49239816-49239838 TATGTTCATCAACAAGTGAATGG + Intronic
1179515174 21:41901279-41901301 TCTCGTCACCACCCAGTCACGGG - Intronic
1181186199 22:21106224-21106246 CCTGTCCACCAACCAATGAAAGG - Intergenic
1181525394 22:23481975-23481997 TCTATTTATCAGCCAGTGAAGGG - Intergenic
1182065843 22:27431127-27431149 TGAGGTCACCAGCCAGTGAAAGG - Intergenic
1182357466 22:29728789-29728811 TCTGTTCTGGAGCCAGTGAATGG + Intronic
956614028 3:71153112-71153134 TCTGTTTACCGACCAGTTAAAGG + Intronic
957166815 3:76684986-76685008 TCTTTCCACCACCCATGGAAAGG + Intronic
958779665 3:98525220-98525242 TCTGTTCACAGCCCAATGAAAGG - Intronic
958825582 3:99026547-99026569 TCTGTCCAGCACCAAGTGTATGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961934553 3:130569563-130569585 TCTGTTCAACTCCCACTGGAAGG + Intronic
962916456 3:139908725-139908747 AGTGTTCTCCACTCAGTGAATGG + Intergenic
964918271 3:161862212-161862234 TGTGTTCACCTCAAAGTGAATGG - Intergenic
965146711 3:164914013-164914035 TCTGTTCACTACCACGTGAACGG + Intergenic
968229024 3:196993565-196993587 TCTGTTCACCAAACTGTTAACGG - Intronic
968528897 4:1079688-1079710 TCTGTTAAACACATAGTGAAAGG + Exonic
969171448 4:5367201-5367223 TCTTGTCACCGTCCAGTGAAAGG + Intronic
969273539 4:6119176-6119198 TCTGTTTACCACCCAGTTTGTGG + Intronic
970832553 4:20359231-20359253 TGTGTTCACCAAGGAGTGAAAGG + Intronic
970881553 4:20938220-20938242 TCAGTTCACCACTCAATTAAAGG + Intronic
975745326 4:77469590-77469612 TCTGTAAACCACCCAGTTTATGG + Intergenic
977369335 4:96115316-96115338 GCTGTTCACCTGACAGTGAATGG - Intergenic
977473779 4:97477060-97477082 ACTGTTCACAACCCAATGACAGG - Intronic
979435247 4:120680550-120680572 AGTGTTCATCAGCCAGTGAATGG + Intergenic
982268273 4:153560197-153560219 TCTTTTCATCACCCATGGAATGG + Intronic
983849794 4:172567078-172567100 TCTCCTCACCCCCAAGTGAATGG - Intronic
984942597 4:184946844-184946866 TCTGATCTCCACCCACTGGATGG + Intergenic
986634720 5:9810184-9810206 TGTTTCCACCATCCAGTGAAAGG + Intergenic
987749238 5:22018466-22018488 TATGTGCAGCACACAGTGAATGG - Intronic
993244050 5:85429181-85429203 TCTGTTCTCCCCCATGTGAAAGG + Intergenic
996582143 5:125043206-125043228 TCTGTTCTCCTCCAACTGAAAGG - Intergenic
998569398 5:143243979-143244001 TCTGTTCCCCACGCAGAGACAGG + Intergenic
999639934 5:153662454-153662476 TCTGATCACCACACTGTGACAGG - Intronic
1000594697 5:163201562-163201584 TCTGTGCAACACTTAGTGAAAGG - Intergenic
1005744050 6:28819780-28819802 TATGTTCACCACCCAGGTGATGG + Intergenic
1013573326 6:111452438-111452460 AATGTTCAGCACCTAGTGAATGG + Intronic
1017554710 6:155550709-155550731 TCTCCTCACCTCCCAGTGGATGG + Intergenic
1019518676 7:1450851-1450873 TCTGTTCACCCTGCAGTGAAGGG + Intronic
1020998572 7:15297686-15297708 TTTGATCACTACCCTGTGAAAGG + Intronic
1021104740 7:16624283-16624305 TCTCTTCACCACCAATTCAATGG + Intronic
1023285019 7:38609894-38609916 TCTGTTCAAAAACCAGTAAAAGG + Intronic
1024148379 7:46540544-46540566 TCTGTTCTCTACCCTGAGAATGG + Intergenic
1031448227 7:121881313-121881335 TATGTTAGCCACCCAGTAAATGG + Intronic
1032542269 7:132712978-132713000 CATGGTCATCACCCAGTGAAGGG - Intronic
1033316334 7:140300596-140300618 TCTGGTCACCACCCAGCGGTTGG + Intronic
1034955821 7:155334001-155334023 TCTGCTGACAGCCCAGTGAAGGG - Intergenic
1035020116 7:155796066-155796088 GCTGGTCACCACCCAGAGAATGG + Intergenic
1035301063 7:157897413-157897435 TCTCTTTAGCACCCAGTGAAGGG - Intronic
1037637568 8:20713480-20713502 TATGTCCATCAGCCAGTGAATGG - Intergenic
1038982496 8:32775277-32775299 TATGTTCGCTACCTAGTGAATGG - Intergenic
1039371528 8:36988847-36988869 TCTGTTCCACACCCAGTCTAGGG + Intergenic
1041256267 8:55982024-55982046 TCTGTTCAGCGCCCAGGGAGAGG - Intronic
1042830876 8:73026807-73026829 TCTGTTCACAGGCCAATGAAGGG - Intronic
1043211454 8:77523998-77524020 TCATTTCACAACCCAGAGAAGGG - Intergenic
1044895517 8:96887419-96887441 TCTGTGTAGCACCCAGTGCAGGG + Intronic
1045111689 8:98942672-98942694 TCAGGTCACCACCCCGTGAGTGG + Intronic
1046598772 8:116293421-116293443 TCTGTTTACCAAACACTGAATGG - Intergenic
1048333039 8:133484127-133484149 TCTGTTCACCACCCAGTGAATGG - Intronic
1057439163 9:95070071-95070093 TGTGATCACCACACAGTGAAAGG + Intronic
1060172577 9:121474071-121474093 TCTGTGCTCCACCCCTTGAAAGG - Intergenic
1060789109 9:126473866-126473888 CCTGTTCACCACCTTGTGTATGG + Intronic
1061234862 9:129336495-129336517 TATCTTCAGCACCCAGTGAGGGG + Intergenic
1186240832 X:7564127-7564149 AATTTTCACCACCCACTGAAAGG + Intergenic
1186412908 X:9359674-9359696 TCTGTTCACCCTCCTGTGAATGG + Intergenic
1193949309 X:87778562-87778584 TCTGTTCACTACCCTGGAAAGGG + Intergenic
1196163641 X:112514036-112514058 TCTGCTCAGCACCAAGTGCATGG + Intergenic
1199736542 X:150691626-150691648 GATGTTCACAATCCAGTGAAGGG - Intergenic
1200453457 Y:3358428-3358450 TCTGTTGACTACCCACTGACTGG - Intergenic
1201460619 Y:14219185-14219207 AATTTTCACCACCCACTGAAAGG + Intergenic