ID: 1048333220

View in Genome Browser
Species Human (GRCh38)
Location 8:133485244-133485266
Sequence TGACCAGTGATAGCTGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048333212_1048333220 18 Left 1048333212 8:133485203-133485225 CCAGCATCCCTGTCCATAGCGCT 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG No data
1048333216_1048333220 5 Left 1048333216 8:133485216-133485238 CCATAGCGCTTTGGAAGTAGTTG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG No data
1048333215_1048333220 10 Left 1048333215 8:133485211-133485233 CCTGTCCATAGCGCTTTGGAAGT 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG No data
1048333211_1048333220 19 Left 1048333211 8:133485202-133485224 CCCAGCATCCCTGTCCATAGCGC 0: 1
1: 0
2: 1
3: 7
4: 96
Right 1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG No data
1048333214_1048333220 11 Left 1048333214 8:133485210-133485232 CCCTGTCCATAGCGCTTTGGAAG 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048333220 Original CRISPR TGACCAGTGATAGCTGGGAC GGG Intronic
No off target data available for this crispr