ID: 1048335455

View in Genome Browser
Species Human (GRCh38)
Location 8:133498953-133498975
Sequence CTGGGTCCAAAAATTCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048335455_1048335462 0 Left 1048335455 8:133498953-133498975 CCCTTCTGAATTTTTGGACCCAG 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1048335462 8:133498976-133498998 GGGCCCTCTCCTTTCAACCCAGG 0: 1
1: 0
2: 11
3: 33
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048335455 Original CRISPR CTGGGTCCAAAAATTCAGAA GGG (reversed) Intronic
905044970 1:34990055-34990077 CTGAGTATCAAAATTCAGAAAGG - Intronic
905999904 1:42415634-42415656 CAGGGTCTATAAATTCAGAGTGG - Exonic
907779160 1:57549499-57549521 CTGAGTCCAGAAAGTCAGATGGG + Intronic
908946812 1:69508704-69508726 CTGTTTACGAAAATTCAGAATGG + Intergenic
909319543 1:74266086-74266108 CTTAGTTCAAAAATTCAGACAGG + Intronic
911660153 1:100492329-100492351 GTGGGTCCAGAGATACAGAAAGG - Intronic
912467745 1:109885726-109885748 TTGGGGCCAGACATTCAGAAGGG + Intergenic
917497338 1:175552785-175552807 TAGGATCCAAAAAGTCAGAACGG - Intronic
918338889 1:183550840-183550862 ATGGGTCCAAAATTGGAGAATGG - Exonic
922067659 1:222159289-222159311 CACAGTCCAAATATTCAGAAAGG - Intergenic
923407899 1:233680821-233680843 CTGAATGAAAAAATTCAGAATGG - Intergenic
923982953 1:239346333-239346355 CTGGACCCTAAAATTCATAAGGG - Intergenic
1064180587 10:13111217-13111239 CTGTGTCTAAAATTCCAGAAAGG - Intronic
1065648423 10:27861672-27861694 CTGCATCAAAAAATACAGAAAGG - Intronic
1066276268 10:33871513-33871535 CTGGGTGCAACAATAAAGAAGGG + Intergenic
1068223157 10:54069174-54069196 CTGGATCCAAAATCTAAGAATGG + Intronic
1074038541 10:109765173-109765195 CTGGGTCAAAATATTCCCAAAGG + Intergenic
1075598292 10:123748256-123748278 CTGGCTCCAAAACTTTAGACTGG - Intronic
1076139357 10:128067632-128067654 CTGGGTCCAAAAGCTGAGAGAGG + Intronic
1077714246 11:4565812-4565834 CTGAGTCCAAGAATTGGGAAGGG - Intergenic
1078352922 11:10609625-10609647 CTGGGTTCAAGAATTAAGACTGG + Intronic
1079641680 11:22813254-22813276 CTTGCTCCAAAAAGTCAGGAAGG + Intergenic
1082214871 11:49557780-49557802 CTGGTTCCCAAAATTCAGCTAGG + Intergenic
1085512516 11:77095557-77095579 CTGAGTCCAACAATTTGGAAAGG - Intronic
1086634709 11:89066690-89066712 CTGGTTCCCAAAATTCAGCTAGG - Intergenic
1087837874 11:102892754-102892776 CTGGATCAAAATATTCACAAGGG - Intergenic
1088444452 11:109909608-109909630 ATGGGTCCAAAAATACAGTTAGG - Intergenic
1089095551 11:115917241-115917263 CATGTTCCAAACATTCAGAAAGG + Intergenic
1092558620 12:9585193-9585215 TTGGGGCCTAAATTTCAGAAAGG - Intergenic
1093178083 12:15935808-15935830 CTGGGTCAAAAATTTGAGAATGG + Intronic
1095202519 12:39400730-39400752 CTAGGTCCAGAAATAGAGAAAGG + Intronic
1095699997 12:45181315-45181337 CTGGGCCCCAAAAGTCAGACAGG - Intergenic
1098517022 12:71388956-71388978 ATGGGTCCAAAATTTCAGCCTGG - Intronic
1098849398 12:75577476-75577498 CTGGGTCCAAATATTCACAGTGG - Intergenic
1100424022 12:94465518-94465540 CTTGGTCCAAAAATACTAAATGG - Intergenic
1102208783 12:111109127-111109149 CTGGGTCCATGAATTCATTAGGG + Intronic
1104378903 12:128290086-128290108 CTGGATCCAAAGGTGCAGAAAGG + Intronic
1106710856 13:32330782-32330804 CTAGGTCCAAAAATTTTTAATGG - Intronic
1107032342 13:35866092-35866114 CTGAGTCCCAGAGTTCAGAATGG - Intronic
1111899881 13:94187897-94187919 CTGGGCCCAGGAATTCAGTATGG - Intronic
1112297492 13:98201095-98201117 ATGGGTACAAAAATACAGCAGGG - Intronic
1114405555 14:22452918-22452940 CAGGGTCCCTAAATACAGAAAGG + Intergenic
1115515839 14:34184083-34184105 CTGGGTCCCAAAGTTCACAAAGG + Intronic
1116487625 14:45469608-45469630 GTGGGTCAGAAAATTTAGAAAGG - Intergenic
1116507687 14:45704939-45704961 CTGGCTCCCAAACTTCAGACTGG + Intergenic
1117018049 14:51539216-51539238 CTAGGTGGAAGAATTCAGAAGGG - Intronic
1118502049 14:66371043-66371065 CTGGGTCAACAAGTTAAGAAGGG + Intergenic
1118640160 14:67784781-67784803 CTGGGTGCTCAAATTCACAATGG + Intronic
1118681188 14:68243495-68243517 CTGGATCAAAAAAATCAGCAAGG - Intronic
1118933902 14:70268493-70268515 GTGGGCCAAAAAATTCATAATGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124721663 15:32115935-32115957 CTGAGTCCAAAAATTCACACAGG + Intronic
1127471110 15:59291136-59291158 CTGGTTGCAAAAATGCTGAAAGG + Intronic
1127724323 15:61733524-61733546 CTGGGTCCAGCCAATCAGAATGG - Intergenic
1128286395 15:66440504-66440526 TTGGGTCTCAAAATTCAGACTGG - Intronic
1129252274 15:74315600-74315622 CAGGCTCTAGAAATTCAGAAAGG + Intronic
1129300311 15:74621632-74621654 CTGGGTCCAACCATCCAGACTGG - Intronic
1129676293 15:77633742-77633764 CTGGGGCCACAACTTCAGACGGG + Intronic
1132165615 15:99585562-99585584 CTGCGTCCAAGACATCAGAAAGG - Intronic
1133759074 16:8783702-8783724 TTGGGTGCAAATATTCAGTATGG + Exonic
1134619456 16:15676580-15676602 CCTGGATCAAAAATTCAGAATGG + Intronic
1134754273 16:16652288-16652310 CAGGGTCAAAATATTCAGATTGG + Intergenic
1134991788 16:18706737-18706759 CAGGGTCAAAATATTCAGATTGG - Intergenic
1135533193 16:23272261-23272283 CTGAGTGGAAAAATTAAGAAAGG - Intergenic
1136898689 16:34013861-34013883 CTGGGTTCAAAAGCTGAGAATGG - Intergenic
1138584762 16:57962614-57962636 CAGGGTCAGAAAATACAGAAAGG + Intronic
1143397600 17:6614751-6614773 CTGGGTCCAAAAATATTCAATGG + Intronic
1144396198 17:14845626-14845648 CTTGTTACAGAAATTCAGAAGGG + Intergenic
1145840352 17:27989197-27989219 CTGGGCCCAAAGATTCAGAGGGG + Intergenic
1146099435 17:29965266-29965288 ATGGGTCAAAAAAATCACAAGGG - Intronic
1146302524 17:31700790-31700812 CAGGGACCAAAAATTGAGAGAGG + Intergenic
1149078783 17:52629686-52629708 CTGCGGCCAACACTTCAGAAAGG + Intergenic
1150249013 17:63695966-63695988 CTGGGCCCAAAGGTTCTGAAGGG + Exonic
1157085849 18:44580265-44580287 CTGGTTCTAAAAATACACAATGG + Intergenic
1157696929 18:49730565-49730587 CTGGGTCCAAGAGCTCTGAAGGG - Intergenic
1157959891 18:52141543-52141565 CTGGGTAAAGAGATTCAGAAGGG - Intergenic
1159282756 18:66309008-66309030 CTTTATCCAAAAATACAGAATGG - Intergenic
1166466764 19:43039680-43039702 CTGTGTCCACAAACTCAGACAGG + Intronic
1166472901 19:43095758-43095780 CTGTGTCCACAAACTCAGACAGG + Intronic
1167088171 19:47324601-47324623 CTGGGTCAACAAGTTCCGAAGGG + Intergenic
925633908 2:5923808-5923830 ATGGGTCCACAAAATCAAAATGG + Intergenic
929726344 2:44432007-44432029 CTGGGTCCAAAAATCTTGGATGG + Intronic
929746456 2:44664774-44664796 CTGTGTCCTAAATTTCTGAAAGG + Intronic
931633028 2:64318190-64318212 CAGAGTCCAAAAAATCAAAATGG - Intergenic
932470373 2:71951161-71951183 CTGGCTCCAAGAAGTCAGATGGG - Intergenic
934158576 2:89226492-89226514 CAGGGTCTGAAGATTCAGAAAGG - Intergenic
934208696 2:89955935-89955957 CAGGGTCTGAAGATTCAGAAAGG + Intergenic
935533505 2:104264480-104264502 ATGGGTCAAAAAAATCAAAAGGG + Intergenic
936152673 2:110030219-110030241 CTGGGTCCACACTTTCAGAGAGG - Intergenic
936404220 2:112187875-112187897 CTGGCTACAAAAAGGCAGAAGGG - Exonic
937189327 2:120079386-120079408 CTGAGTCAGAGAATTCAGAAAGG - Intronic
939929621 2:148216973-148216995 TTAGGTCCTAAAATGCAGAAGGG - Intronic
942590537 2:177541295-177541317 CTGGGTGCTAACATGCAGAAAGG - Exonic
943875643 2:193063954-193063976 ATGGGTACAAATATACAGAAAGG - Intergenic
944641941 2:201736354-201736376 GTGAGTCCAATAATTCATAATGG + Intronic
944843907 2:203650038-203650060 CTGTGTCCAAAATTACAGAAGGG - Intergenic
945405523 2:209443137-209443159 CTGAGGCCAAAAATACAGGAAGG - Intronic
946430782 2:219626411-219626433 CTGTGCCCCAAAACTCAGAATGG - Intergenic
1169280029 20:4259196-4259218 TTGGGTTCAGAAATCCAGAAGGG + Intergenic
1174109384 20:48187605-48187627 CTGGCTTCAACAAATCAGAAGGG + Intergenic
1175194864 20:57236075-57236097 CTGGGTGCCAGAATTAAGAAAGG - Intronic
1177363815 21:20107669-20107691 CTGGTACTAAAAATTCAGTAGGG + Intergenic
1179712290 21:43270228-43270250 CTGGGGCCAAAAATGCTAAAAGG + Intergenic
1184039118 22:41932998-41933020 CTGGGGAGAAAAAGTCAGAAGGG + Intergenic
1184857085 22:47152260-47152282 ATGGGTTCAAAAATCCAGACTGG + Intronic
949294754 3:2508275-2508297 CTGGGAACAAAATTTCAAAAGGG - Intronic
952904348 3:38129744-38129766 CAGGGCCCACAAATTCAGAAGGG + Intronic
953222984 3:40990069-40990091 CTAGCTGCAAAAATTCAGATGGG - Intergenic
956619074 3:71202231-71202253 TTGGGACCAAAATTGCAGAAAGG + Intronic
958631136 3:96685410-96685432 GTGGGTCCAGAAATTCTGTATGG + Intergenic
961531368 3:127542334-127542356 CAGGGCCCAAAAGTTCAAAAGGG + Intergenic
963877043 3:150487875-150487897 CTGGGTCAAAAAAATCAAAAAGG + Intergenic
964151117 3:153525658-153525680 CTTTGACCAAAAATTCAAAATGG - Intergenic
964770257 3:160217711-160217733 CTCTGTTTAAAAATTCAGAATGG - Intergenic
966054932 3:175675305-175675327 TTGGGGGCAAAAACTCAGAATGG - Intronic
970296461 4:14636142-14636164 CTTAGTCCAAAACCTCAGAAGGG + Intergenic
970928462 4:21481457-21481479 CTGGGTCAGAGAATTCTGAAGGG + Intronic
971090897 4:23344383-23344405 GTGTGCACAAAAATTCAGAAAGG + Intergenic
972536448 4:40003869-40003891 CTGGGTCAAGTAATTCAGCACGG + Intergenic
974512430 4:62861521-62861543 CTGGGTGCAAACATTTTGAAAGG + Intergenic
978571373 4:110141469-110141491 CTGGGACCACACACTCAGAAAGG + Intronic
984565737 4:181328193-181328215 CTTAATCCAAAAATTCAGGAAGG - Intergenic
985142922 4:186861662-186861684 CTGGCTGCAAAAATTAAAAAGGG + Intergenic
985206600 4:187544637-187544659 CTTGGGACAAAAATTCATAATGG + Intergenic
986309336 5:6540333-6540355 CTGGATGCAGAAAATCAGAATGG - Intergenic
987181485 5:15372748-15372770 CTTGGTGCAAAATTTCAGAGGGG - Intergenic
991389373 5:66125814-66125836 CTGAGTCCAAAAAGTGTGAAGGG + Intergenic
993002174 5:82392247-82392269 TTGGGTCCAAGATTTCAAAATGG + Intergenic
993792777 5:92227486-92227508 ATGGGGCAAAATATTCAGAATGG - Intergenic
994060344 5:95469602-95469624 CTGGTTCCAGAAATCCAGTAAGG - Intronic
994065314 5:95533562-95533584 CTGCAACCAACAATTCAGAAGGG + Intronic
997222397 5:132180388-132180410 CTGCGTCAAAAATTTAAGAATGG + Intergenic
997428279 5:133819312-133819334 CTGCATCTAAAAACTCAGAAGGG - Intergenic
997610564 5:135212919-135212941 TTTGGACCAAGAATTCAGAAAGG - Intronic
998936090 5:147232540-147232562 ATGGTTCCTAATATTCAGAAGGG + Intergenic
999593304 5:153172989-153173011 CTGGTTCCTACAAGTCAGAAAGG + Intergenic
999958873 5:156732632-156732654 CTGTGACAAAAAATTGAGAAGGG - Intronic
1005349130 6:24917181-24917203 TTGGGACCAAAAATTCAAAAAGG - Intronic
1008105787 6:47439894-47439916 CTGGGAACTAAATTTCAGAAGGG - Intergenic
1008110202 6:47483754-47483776 CTGGGACCAAATAAACAGAAGGG - Intronic
1008468833 6:51860288-51860310 CAGGGGCCAAAAATTCAGTCAGG + Intronic
1009525874 6:64745699-64745721 CTATGTCCAAAAATCCAGAAGGG + Intronic
1010060824 6:71620726-71620748 CTGGGTCCAAGGGTTCACAAAGG - Intergenic
1011149912 6:84259497-84259519 CTGTGATCCAAAATTCAGAAAGG - Intergenic
1013751785 6:113415525-113415547 ATGGGTCAAAAAAGTCATAAAGG - Intergenic
1017318521 6:153060827-153060849 CTGGGTTCAGAATTTCATAATGG - Intronic
1020185866 7:5959009-5959031 CTGGGTACAAAACATCAAAAAGG - Exonic
1020297051 7:6765753-6765775 CTGGGTACAAAACATCAAAAAGG + Exonic
1021262301 7:18473096-18473118 CTGGGACCAGAGATTCAGCAAGG - Intronic
1021416340 7:20389595-20389617 ATGTTTCCAAAAATTAAGAAGGG + Intronic
1023610920 7:41969555-41969577 CTGAGGCCAAAAATTAAGCAAGG - Intronic
1024109510 7:46131004-46131026 CATTGTCCTAAAATTCAGAATGG + Intergenic
1026662267 7:72312628-72312650 CAGGTTCAGAAAATTCAGAAAGG + Intronic
1027909138 7:84226220-84226242 CAGGGAACATAAATTCAGAATGG + Intronic
1028330173 7:89580418-89580440 TTGGGCCTAAAAATTGAGAATGG + Intergenic
1030050017 7:105529670-105529692 ATGGGTCCAAAAATACAGTTAGG + Intergenic
1030956551 7:115859977-115859999 CTGGGTACAAAAATGCTCAAGGG - Intergenic
1032990773 7:137392748-137392770 CAGGTTCCAAATATTCAGAGAGG + Intronic
1036790316 8:11713438-11713460 CTGGGTCCAACCACACAGAATGG + Intronic
1038297551 8:26309431-26309453 TTGGGCCCTAGAATTCAGAATGG + Intronic
1038447451 8:27613909-27613931 CTAGGTCCAGAAATTCTGGAAGG + Intronic
1039151397 8:34510591-34510613 CTAGTTCCCAGAATTCAGAATGG + Intergenic
1039250353 8:35657313-35657335 CTGTGGCCAAAAAATCTGAAGGG + Intronic
1041218663 8:55627070-55627092 CTGGGTCCAGAAATCCACACTGG + Intergenic
1042060278 8:64809184-64809206 CTGGATACAAAACTTCAGGAAGG + Intergenic
1043072357 8:75654687-75654709 CTGGTTCCAAAATTTAGGAAAGG - Intergenic
1044317203 8:90763713-90763735 CTGGGTCAGAAAACTCAGAAGGG + Intronic
1045356144 8:101390794-101390816 CTGGTTCCACAAACTAAGAAGGG + Intergenic
1046011331 8:108551810-108551832 CTGTTTCAAAAAATTGAGAAGGG + Intergenic
1048335455 8:133498953-133498975 CTGGGTCCAAAAATTCAGAAGGG - Intronic
1048510420 8:135056909-135056931 CTAATTCCAAATATTCAGAAAGG + Intergenic
1050744755 9:8862437-8862459 ATGGGTCAAAAAATTTAGCATGG - Intronic
1052805205 9:33007071-33007093 CTGAGTCCAGAAAGACAGAAAGG + Intronic
1056433169 9:86548657-86548679 CGGGCTCCAAAACTTCAGAAAGG - Intergenic
1058105084 9:100961397-100961419 CTGCCTCCAAAAATTCTGGAAGG - Intergenic
1059703698 9:116800400-116800422 CTGTGTGCAAAAATTAAGCATGG - Intronic
1059973838 9:119694915-119694937 CTAGGGGCAAAGATTCAGAAGGG + Intergenic
1186536162 X:10350846-10350868 CTTGGTTCAAAAACCCAGAAAGG - Intergenic
1188401222 X:29747253-29747275 CTGGCTTCAGAAATTCACAATGG - Intronic
1190449740 X:50566839-50566861 ATGGCTCCAAAAATTCAGAATGG + Intergenic
1190738120 X:53269177-53269199 CTGGGTCAGGAAATTCAGAAAGG - Intronic
1196484224 X:116185917-116185939 CTGAGACCAAAAATTTACAAAGG + Intergenic
1196996645 X:121390709-121390731 CTGGGTCCAGAGATGAAGAATGG + Intergenic
1197472082 X:126876857-126876879 CTGGGTCAAAAGAATCTGAACGG - Intergenic
1197849216 X:130839186-130839208 CTGCCTCCAGAAAATCAGAAAGG - Intronic
1198301755 X:135340427-135340449 CAGGCTTTAAAAATTCAGAAAGG - Intronic