ID: 1048337763

View in Genome Browser
Species Human (GRCh38)
Location 8:133515505-133515527
Sequence GGTCAAAACCTCATTCGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048337763_1048337767 -10 Left 1048337763 8:133515505-133515527 CCCCTACGAATGAGGTTTTGACC 0: 1
1: 0
2: 3
3: 8
4: 42
Right 1048337767 8:133515518-133515540 GGTTTTGACCCAGTAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048337763 Original CRISPR GGTCAAAACCTCATTCGTAG GGG (reversed) Intronic
905517884 1:38575545-38575567 GCTCAAGACATCATTCGTGGTGG + Intergenic
907342712 1:53748266-53748288 CTTCAAAACCTCATTCAGAGAGG + Intergenic
915919931 1:159968557-159968579 GGTCAAATCCTTCTTTGTAGGGG + Intergenic
1063262195 10:4402340-4402362 GGTCAGAACTTCATTCATAAAGG + Intergenic
1064481277 10:15743291-15743313 GGTTAAAACCTCATTCTGATGGG - Intergenic
1093641240 12:21528888-21528910 GGTCAAAATCTATTTCATAGAGG + Intronic
1094516583 12:31133878-31133900 GGTCAAAAGCTTCTTAGTAGAGG - Intergenic
1098169636 12:67733801-67733823 GGTCAAAACCCCTTTTGTGGAGG - Intergenic
1105626004 13:22113214-22113236 GGTCAAACCCGCATTCGTAAGGG + Intergenic
1125251225 15:37707087-37707109 GCTCAAGACTTCATACGTAGAGG + Intergenic
1126507257 15:49419530-49419552 GGTCAAAACTTAATTCCTATTGG - Intronic
1147933520 17:43997736-43997758 GGTCGAAGCCGCATTCGTAAGGG - Intronic
1153253821 18:3150451-3150473 GGGCAAAACCACCTTTGTAGAGG - Intronic
1155878314 18:31113531-31113553 GGTGAAAACCTGATTAGAAGTGG - Intergenic
1158196594 18:54893230-54893252 GGAAAAATCCTCATTCGTAAAGG + Exonic
1166786139 19:45368471-45368493 GGTCAAATTCTCATTCATCGTGG - Intronic
933539026 2:83615712-83615734 GCTCAAAACCTCATCAGGAGAGG - Intergenic
933982473 2:87563227-87563249 GGTGAAAACCTCATTGGAAAAGG + Intergenic
936311370 2:111387566-111387588 GGTGAAAACCTCATTGGAAAAGG - Intergenic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
938309427 2:130278140-130278162 AGTCAAATCCGCATTTGTAGGGG - Intergenic
938446068 2:131379957-131379979 AGTCAAATCCTCATTCGTAGGGG + Intergenic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
946045540 2:216817976-216817998 GGTCAAAACCTCTGTGGAAGTGG - Intergenic
948376447 2:237524106-237524128 GGTCAAATCCTCATTGACAGGGG + Intronic
948514019 2:238491619-238491641 GGTCAAAATCTCCATCCTAGGGG - Intergenic
1179721047 21:43316225-43316247 GGTGAAAACCTCAGTGGGAGGGG - Intergenic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
961738422 3:129016702-129016724 GGTCAAACCCTGACTCGTACAGG + Intronic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
972262776 4:37427256-37427278 CATTAAAACCTCATTCTTAGTGG + Intronic
973841140 4:54861922-54861944 GGTCAAAAGCTCTTTCCTAGGGG - Intergenic
982539857 4:156654827-156654849 GGTTAAAACCTGATTAGTAATGG - Intergenic
987027692 5:13944087-13944109 GGTCAAAAACACATTCATAGTGG - Intronic
987793089 5:22593644-22593666 GGTCAAAACCTAACTCCAAGTGG + Intronic
989539191 5:42599165-42599187 GGTCAATACCTTATTGGAAGAGG + Intronic
994459088 5:100050937-100050959 GGTCGAAGCCACATTCGTAAGGG + Intergenic
995491099 5:112692267-112692289 GATCCAGACCTCATTGGTAGAGG - Intergenic
1004321786 6:14637382-14637404 GGCCAAGACCTCATCCGTTGTGG - Intergenic
1009910528 6:69920215-69920237 GGTCAAAGCCTCACTGGCAGTGG + Intronic
1011617719 6:89212293-89212315 GGTGCAAAGCTCATTCATAGTGG - Intronic
1017368037 6:153668281-153668303 GGTGAAACCCACATTCTTAGGGG - Intergenic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1025229495 7:57192095-57192117 GGTCAAATCTGCATTCGTAGGGG - Intergenic
1025730851 7:64105869-64105891 GGTCAAATCTGCATTTGTAGGGG + Intronic
1048337763 8:133515505-133515527 GGTCAAAACCTCATTCGTAGGGG - Intronic
1053751092 9:41255769-41255791 GGTCATAAACTCCTTCATAGTGG - Intergenic
1054256611 9:62820102-62820124 GGTCATAAACTCCTTCATAGTGG - Intergenic
1054334698 9:63795514-63795536 GGTCATAAACTCCTTCATAGTGG + Intergenic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1061954276 9:133953515-133953537 GGTCAAAACCACATTTTCAGAGG - Intronic
1185758378 X:2670375-2670397 GGAAAACACCTCATTTGTAGTGG - Intergenic
1195671593 X:107474572-107474594 GGCAAAAATCTCATTGGTAGGGG + Intergenic