ID: 1048343082

View in Genome Browser
Species Human (GRCh38)
Location 8:133555646-133555668
Sequence CCATTTAGGACCCACCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048343076_1048343082 10 Left 1048343076 8:133555613-133555635 CCTTGCTTGCACCTCATTACCGA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1048343082 8:133555646-133555668 CCATTTAGGACCCACCTGATTGG No data
1048343078_1048343082 -1 Left 1048343078 8:133555624-133555646 CCTCATTACCGAAAGGATCAAGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1048343082 8:133555646-133555668 CCATTTAGGACCCACCTGATTGG No data
1048343079_1048343082 -9 Left 1048343079 8:133555632-133555654 CCGAAAGGATCAAGCCATTTAGG 0: 1
1: 0
2: 1
3: 8
4: 104
Right 1048343082 8:133555646-133555668 CCATTTAGGACCCACCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048343082 Original CRISPR CCATTTAGGACCCACCTGAT TGG Intronic
No off target data available for this crispr