ID: 1048344902

View in Genome Browser
Species Human (GRCh38)
Location 8:133569164-133569186
Sequence CCAGGACCTGGGCTTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 710
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 677}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048344902_1048344910 12 Left 1048344902 8:133569164-133569186 CCCTGCTCAAGCCCAGGTCCTGG 0: 1
1: 0
2: 1
3: 31
4: 677
Right 1048344910 8:133569199-133569221 AGACTCTAAACAGCAAATGCCGG No data
1048344902_1048344912 29 Left 1048344902 8:133569164-133569186 CCCTGCTCAAGCCCAGGTCCTGG 0: 1
1: 0
2: 1
3: 31
4: 677
Right 1048344912 8:133569216-133569238 TGCCGGCCCAGAAAAATGCAGGG No data
1048344902_1048344911 28 Left 1048344902 8:133569164-133569186 CCCTGCTCAAGCCCAGGTCCTGG 0: 1
1: 0
2: 1
3: 31
4: 677
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048344902 Original CRISPR CCAGGACCTGGGCTTGAGCA GGG (reversed) Intronic
900270287 1:1783561-1783583 CCAGCACCTTGCCTGGAGCAGGG + Intergenic
900572059 1:3363496-3363518 GCAGGATCTGGGCCTGAGAAGGG - Intronic
900987234 1:6080292-6080314 CCAGCACCAGGGCTCCAGCACGG - Intronic
900998037 1:6133450-6133472 CCAGACTCTGGGTTTGAGCAAGG + Intronic
901897134 1:12323725-12323747 GCAGGAGCTGGGATTCAGCATGG + Exonic
902045875 1:13523981-13524003 CCCAGGCCCGGGCTTGAGCATGG - Intergenic
902692188 1:18116939-18116961 CCAGGACCTGCACTTAAGCAAGG - Intronic
902734575 1:18391754-18391776 CCAAGACCAGGGATTCAGCAGGG + Intergenic
902838888 1:19063116-19063138 CCACGTCCTGGGGTTGGGCAGGG - Intergenic
903447282 1:23430735-23430757 CCCAGCCCTGGGCTGGAGCATGG + Intronic
904567030 1:31434322-31434344 CCAGGACCTGCCCCTGAGCCGGG + Exonic
904965037 1:34365459-34365481 CCATGAGCTGGCCTTGAGAATGG - Intergenic
905182937 1:36177931-36177953 CCTGGCCCTGGGCTGGGGCAGGG - Exonic
905333183 1:37223080-37223102 CAAGGACCTGGGCAGGGGCATGG + Intergenic
905915701 1:41682816-41682838 CCAGGCCCTGGGCTTGGCCTGGG + Intronic
906452476 1:45962831-45962853 TCAGGACATAGGCATGAGCAAGG - Intronic
906458283 1:46017248-46017270 TCAGGACATAGGCTTGGGCAAGG + Intronic
906545353 1:46616253-46616275 CCAGGATCTGGGCCAGAGGATGG + Intronic
906756080 1:48316605-48316627 TCAGGACATAGGCATGAGCAAGG + Intronic
906759672 1:48364866-48364888 TCAGGACATGGGCATGGGCAAGG - Intronic
906869727 1:49464931-49464953 CCAGTACCTGGTCTTGAGCTAGG - Intronic
907240385 1:53077817-53077839 CCAGGTCCTTGGCGTGACCACGG + Intronic
907442763 1:54488997-54489019 CCTGGGCCTGGGTTTGAGCTGGG + Intergenic
907453035 1:54559349-54559371 CCTGTGCCTGGGCTGGAGCAGGG + Intronic
909259646 1:73470771-73470793 TCAGGACATAGGCTTGGGCAAGG + Intergenic
909414268 1:75387133-75387155 TCAGGACATAGGCTTGTGCAAGG + Intronic
909520227 1:76559582-76559604 TCAGGACTTGGGGTGGAGCAAGG + Intronic
909770830 1:79419208-79419230 TCAGGACATAGGCTTGGGCAAGG + Intergenic
909811719 1:79939456-79939478 TCAGGACATAGGCTTGGGCAAGG - Intergenic
910759950 1:90723967-90723989 CCAGGGCCAGGGCCTAAGCAGGG - Intergenic
911705149 1:101002743-101002765 GCAGAACCTGGTCTGGAGCAAGG + Intronic
911729073 1:101273119-101273141 TCAGGACATAGGCATGAGCAAGG - Intergenic
911827424 1:102505248-102505270 CCAGGACATAGGCATGGGCAAGG - Intergenic
911938122 1:104007215-104007237 TCAGGACATAGGCATGAGCAAGG - Intergenic
911991143 1:104698198-104698220 TCAGGACCTAGGCATGGGCAAGG + Intergenic
912103408 1:106240414-106240436 TCAGGACATAGGCATGAGCAAGG - Intergenic
912151961 1:106870587-106870609 TCAGGACATGGGCATGGGCATGG - Intergenic
912156815 1:106931068-106931090 TCAGGACATAGGCTTGGGCAAGG - Intergenic
912374375 1:109198448-109198470 TCAGGACTTGGGCTTTAGCCTGG - Intronic
912616795 1:111110083-111110105 ACAGTACCTGGGTTTGTGCAAGG + Intergenic
912757965 1:112340358-112340380 CCAGGACATAGGCATGGGCAAGG + Intergenic
912889494 1:113513700-113513722 TCAGGACCTAGGCATGGGCAAGG + Intronic
913466883 1:119152004-119152026 TCAGGACATAGGCATGAGCAAGG - Intergenic
916033415 1:160899184-160899206 TCAGGACATAGGCATGAGCAAGG + Intergenic
916750947 1:167722253-167722275 CCAGGACCAGGGCTGGGGCCGGG + Intronic
921717058 1:218428403-218428425 TCAGGACATGGGCATGGGCAAGG - Intronic
921835700 1:219775949-219775971 TCAGGACATAGGCATGAGCAAGG - Intronic
921846806 1:219891754-219891776 TCAGGACATGGGCATGGGCAAGG + Intronic
922376751 1:224976410-224976432 TCAGGACATAGGCTTGGGCAAGG + Intronic
922569318 1:226624538-226624560 ACAGCACCTGGGCTTGGGCAGGG - Intergenic
922702831 1:227771756-227771778 CCAGGACCCTGGGCTGAGCAGGG + Intronic
924575273 1:245275396-245275418 TCAGGACCTAGGCATGGGCAAGG - Intronic
924578389 1:245301291-245301313 CTTGGAACTGAGCTTGAGCAGGG + Intronic
1063071931 10:2675447-2675469 CCAAGTCCTGGGCTTGAACCAGG + Intergenic
1063324511 10:5084145-5084167 TCAGGACATAGGCTTGGGCAAGG - Intronic
1063495058 10:6499416-6499438 TGAGGACCTGGGCTTCAGCAAGG - Intronic
1064473874 10:15665584-15665606 CCAGGACATAGGCATGGGCAAGG - Intronic
1066640883 10:37553182-37553204 CCTGGTCCAGGGCTTGGGCAAGG - Intergenic
1066655686 10:37697889-37697911 TCAGGACATGGGCATGGGCAAGG + Intergenic
1066788081 10:39028028-39028050 TCAGGACATGGGCATGGGCAAGG + Intergenic
1066983378 10:42440321-42440343 TCAGGACATGGGCATGGGCAAGG + Intergenic
1067369561 10:45670756-45670778 TCAGGACATAGGCATGAGCACGG + Intronic
1067712107 10:48657599-48657621 CCTGGCCATGGGCATGAGCATGG - Intergenic
1067801116 10:49360407-49360429 CCAGGGCCAGGGCTACAGCAAGG + Intergenic
1068556473 10:58464625-58464647 CCAGGCTCTGGGCTTGTGCTGGG + Intergenic
1068806625 10:61201893-61201915 CCAGGACATAGGCATGGGCAAGG + Intergenic
1069950165 10:72013161-72013183 GCAGGACCTGGGAGGGAGCAGGG - Exonic
1070893500 10:79961219-79961241 TCAGGACATAGGCTTGGGCAAGG + Intronic
1071243968 10:83742296-83742318 TCAGGACATGGGCATGGGCAAGG - Intergenic
1071294789 10:84211733-84211755 CCAGGACAGGGCCTTGGGCAAGG + Intronic
1071350127 10:84732288-84732310 CCAGGACATAGGCATGGGCAAGG + Intergenic
1071450918 10:85790821-85790843 CCAGGACAAGGGCTTGGTCAAGG - Intronic
1072834926 10:98700567-98700589 CCAGGACATAGGCATGGGCAAGG + Intronic
1073587087 10:104721044-104721066 TCAGGACATAGGCATGAGCAAGG - Intronic
1074304833 10:112267635-112267657 CCAGTACCTGGTCTTGAGGGAGG - Intergenic
1074925627 10:118067287-118067309 TCAGGACATAGGCATGAGCAAGG + Intergenic
1075204834 10:120437835-120437857 GAAGGACGTGGCCTTGAGCAGGG - Intergenic
1076294425 10:129373777-129373799 CCTGGACCTGGGCTTGGCCCTGG + Intergenic
1076783853 10:132739355-132739377 CCAGGGGCTGGGCCTGAGCTTGG - Intronic
1077271119 11:1681808-1681830 CCAGGACCTGGGGCTTGGCAAGG + Intergenic
1077351434 11:2094955-2094977 CCAGGCCCTGGGGTCGAGCCTGG - Intergenic
1077475749 11:2789667-2789689 CCAGGAGCTGGGCCTGGGAAGGG - Intronic
1077544283 11:3162415-3162437 TCAGGACCAGGGCTTGAGGTGGG - Intronic
1078105289 11:8354550-8354572 CCTAGACCTGTGCTTGAGCTGGG - Intergenic
1078419300 11:11195542-11195564 TCAGGACATAGGCATGAGCAAGG - Intergenic
1079076636 11:17388860-17388882 CCAGGACCTGAGCTGGAGCCTGG - Intronic
1079116467 11:17643498-17643520 GCAGGACCTGTGAGTGAGCATGG + Exonic
1079753022 11:24222159-24222181 TCAGGACATAGGCATGAGCAAGG + Intergenic
1081651558 11:44827411-44827433 CCTGGGCCTGGGCTTGGGTAGGG - Intronic
1081768717 11:45632646-45632668 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1082067972 11:47916198-47916220 CCAGGAACTGGGTCTGAGGATGG - Intergenic
1082687590 11:56259718-56259740 CCAGGACCTGTGCTTGCACCTGG - Intergenic
1083165773 11:60886132-60886154 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1083509760 11:63197647-63197669 TCAGGACCTAGGCATGGGCAAGG + Intronic
1084386741 11:68847852-68847874 CCAGGACCTGAGCTTCTTCATGG + Intergenic
1084444661 11:69196653-69196675 ACAGGAGCTGGGGGTGAGCAAGG - Intergenic
1084456874 11:69273109-69273131 CCAGGAGCTGGGCTTGGGTGGGG - Intergenic
1084470294 11:69355549-69355571 CCAGGACCTGGCCCAGGGCAGGG - Intronic
1084929155 11:72540316-72540338 CCAGGACCTGGCCTTGGGACTGG - Intergenic
1085029270 11:73259769-73259791 CCAGGAGGTGGGGTTGATCATGG - Intergenic
1085456128 11:76666308-76666330 CCAGTCCCTGGCCCTGAGCATGG - Intronic
1085964265 11:81501486-81501508 CCAGGACATAGGCATGGGCAAGG + Intergenic
1086024762 11:82277546-82277568 TCAGGACATAGGCATGAGCAAGG - Intergenic
1086152737 11:83630299-83630321 CCAGGACCAGGGCTAGAGTTGGG + Intronic
1086306028 11:85482398-85482420 ATAGGATCTGGCCTTGAGCATGG - Intronic
1086352143 11:85953076-85953098 TCAGGACATGGGCATGGGCAAGG - Intergenic
1086410069 11:86536208-86536230 TCAGGACATAGGCATGAGCAAGG + Intronic
1088846937 11:113676177-113676199 TCTGGAGCTGGGCTTGAGCCAGG - Intergenic
1089106428 11:116009966-116009988 TCAGGACATTGGCTTGGGCAAGG + Intergenic
1089260715 11:117222126-117222148 GCAGGAGCTGGGCTGGAGCCAGG - Intronic
1091077435 11:132633558-132633580 CCAGGCCCTGGGTCTGAGCCTGG + Intronic
1091825816 12:3511925-3511947 CCAGGACATAGGCCTGAGCCAGG + Intronic
1092421281 12:8333995-8334017 TCAGGACATAGGCATGAGCAAGG + Intergenic
1092707710 12:11302594-11302616 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1092718917 12:11421055-11421077 TCAGGACATAGGCTTGGGCAAGG + Intronic
1092779439 12:11971653-11971675 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1093093529 12:14947093-14947115 CCAGGGCCTGGGCTCCACCAAGG - Intronic
1093178814 12:15944797-15944819 TCAGGACATAGGCATGAGCAAGG - Intronic
1093991189 12:25591557-25591579 CCAGGCCCTGGGCATGTCCAGGG - Intronic
1095191667 12:39264796-39264818 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1095210485 12:39488381-39488403 TCAGGACATGGGCATGGGCAAGG + Intergenic
1096100501 12:48968091-48968113 CCAGGGCTGGGGCTTGAGCCAGG + Exonic
1096139928 12:49234520-49234542 CCAGGGCCTGGGCCTGGGCTCGG + Intronic
1096214235 12:49790916-49790938 CCTGGGCCAGGGCTTGGGCACGG - Intergenic
1096494825 12:52033861-52033883 TCAGGGCCAGGGCCTGAGCAGGG + Intronic
1097319072 12:58205572-58205594 CCAGGACCTGGACTAGGGTAAGG - Intergenic
1097627501 12:62018747-62018769 TCAGGACATGGGCATGGGCAAGG + Intronic
1097741284 12:63245448-63245470 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1098015015 12:66095501-66095523 CCAGGACATAGGCATGGGCAAGG - Intergenic
1098669547 12:73208359-73208381 TCAGGACATAGGCATGAGCAAGG + Intergenic
1098803811 12:74996272-74996294 TCAGGACATAGGCATGAGCAAGG + Intergenic
1099678320 12:85790473-85790495 CCAGGACATAGGCATGGGCAAGG + Intergenic
1099696045 12:86020659-86020681 CCAGGACATAGGCATGGGCAAGG + Intronic
1099726896 12:86442412-86442434 TCAGGACATAGGCATGAGCAAGG - Intronic
1099820004 12:87697338-87697360 TCAGGACATGGGCATGGGCAAGG - Intergenic
1099839535 12:87948256-87948278 TCAGGACATAGGCATGAGCAAGG + Intergenic
1099912653 12:88851917-88851939 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1100152079 12:91750855-91750877 TCAGGACATAGGCTTGGGCAAGG - Intergenic
1100742009 12:97604283-97604305 TCAGGACATAGGCATGAGCAAGG - Intergenic
1100966196 12:100015750-100015772 CCAGGACATAGGCATGGGCAAGG + Intergenic
1101088672 12:101262167-101262189 CCAGGACATAGGCATGGGCAAGG - Intergenic
1101174786 12:102138555-102138577 TCAGGACATAGGCATGAGCAAGG - Intronic
1101175503 12:102146640-102146662 TCAGGACATAGGCATGAGCAAGG + Intronic
1101401281 12:104389629-104389651 TCAGGACATAGGCTTGAGCAAGG - Intergenic
1102439267 12:112948978-112949000 CCAGGAGCTGGGCATGAGGGAGG - Exonic
1103918040 12:124386000-124386022 AGAGGTCCTGGGCCTGAGCAGGG - Intronic
1104948658 12:132428849-132428871 CCTGGGCCTGGGGTGGAGCAGGG - Intergenic
1105405095 13:20127101-20127123 TGAGGACCTGGGCTTCAGCTGGG + Intergenic
1105520544 13:21127139-21127161 CCAGGCCAGGGGCTGGAGCAGGG - Intergenic
1105990672 13:25616925-25616947 CCAGGATCTGGGCTAGAGGGTGG + Intronic
1107091599 13:36487266-36487288 TCAGGACATGGGCATGGGCAAGG - Intergenic
1107322799 13:39207385-39207407 TCAGGACATGGGCATGGGCAAGG - Intergenic
1107567311 13:41618542-41618564 TCAGGACATAGGCATGAGCAAGG - Intronic
1107712323 13:43162348-43162370 TCAGGACATGGGCATGGGCAAGG + Intergenic
1107971789 13:45649976-45649998 GCAGGACATAGGCATGAGCAAGG + Intergenic
1108717976 13:53100651-53100673 CCACTATCTGGGCTTCAGCATGG + Intergenic
1109496791 13:63181869-63181891 TCAGGACATAGGCATGAGCAAGG + Intergenic
1109721468 13:66281707-66281729 TCAGGACCTAGGCATGGGCAAGG - Intergenic
1109946217 13:69435622-69435644 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1110789652 13:79573752-79573774 TCAGGACATGGGCATGGGCAAGG + Intergenic
1111398523 13:87700540-87700562 TCAGGACATGGGCATGGGCAAGG - Intergenic
1111686084 13:91502313-91502335 TCAGGACATAGGCATGAGCAAGG - Intronic
1112166754 13:96927951-96927973 CCAGGATCTGAGCTTCTGCAAGG - Intergenic
1113596978 13:111540265-111540287 CTGGGTCCTGGGCCTGAGCATGG + Intergenic
1113650235 13:112029260-112029282 GCAGGACCTGGGCTGGAGTGGGG + Intergenic
1113973680 13:114210737-114210759 GCTGGAGCTGGGCTTGAGCTGGG - Intergenic
1114386150 14:22257426-22257448 TCAGGACATAGGCATGAGCAAGG - Intergenic
1114597771 14:23928363-23928385 GCAGGACCTGGACTTGAACTTGG + Intergenic
1115067708 14:29284828-29284850 TCAGGACGTGGGCATGGGCAAGG + Intergenic
1115094652 14:29620247-29620269 TCAGGACATAGGCATGAGCAAGG + Intronic
1115734614 14:36311158-36311180 TGAGGACTTGGGTTTGAGCAGGG + Intronic
1116376819 14:44212871-44212893 TCAGGACATAGGCTTGGGCAAGG - Intergenic
1116538428 14:46065596-46065618 TCAGGACATAGGCTTGGGCAAGG - Intergenic
1116590405 14:46764395-46764417 TCAGGACATAGGCATGAGCAAGG + Intergenic
1116985459 14:51214677-51214699 TCAGGACATAGGCATGAGCAAGG - Intergenic
1117005204 14:51414221-51414243 TCAGGACATAGGCATGAGCAAGG - Intergenic
1117505304 14:56396495-56396517 TCAGGACATAGGCATGAGCAAGG + Intergenic
1118081150 14:62362206-62362228 CCAGAACCTGTTCTTGAGGATGG + Intergenic
1118803991 14:69218595-69218617 CCAGGACATAGGCATGGGCAAGG - Intronic
1119594452 14:75921293-75921315 TCAGGACATAGGCATGAGCAAGG - Intronic
1119916974 14:78411372-78411394 CCAGGGCCTGTGCTGCAGCAGGG - Intronic
1120615190 14:86695450-86695472 CCAGGACATAGGCATGGGCAAGG + Intergenic
1121670707 14:95708950-95708972 CCAGGAACTGGGACTCAGCAGGG - Intergenic
1121692319 14:95886627-95886649 CCAGGACATGGGCCTGGGAAGGG + Intergenic
1122062107 14:99143071-99143093 CAGGGACCTGGGCTTGAGATTGG - Intergenic
1122838339 14:104442357-104442379 GCAGGACCTGGGCCTGGGCAGGG + Intergenic
1123157603 14:106243973-106243995 TCAGGACATAGGCTTGGGCAAGG - Intergenic
1202869441 14_GL000225v1_random:146876-146898 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1123397651 15:19953274-19953296 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1123421967 15:20142287-20142309 TCAGGACCAGGGCTGGACCAGGG + Intergenic
1123531195 15:21148827-21148849 TCAGGACCAGGGCTGGACCAGGG + Intergenic
1124701075 15:31912693-31912715 TCAGGACATGGGCATGGGCAAGG - Intergenic
1125225029 15:37386376-37386398 TCAGGACATAGGCATGAGCAAGG - Intergenic
1125355530 15:38813694-38813716 TCAGGACATAGGCATGAGCAAGG + Intergenic
1125600377 15:40912381-40912403 GCAGAACCTGGGGTTAAGCAGGG + Intergenic
1125641058 15:41231114-41231136 GCAGGACTTGGGCTGGAGCTGGG + Intronic
1125980338 15:43995462-43995484 ACAGGAGCTGGCCTGGAGCATGG + Intronic
1126414294 15:48401765-48401787 CCAGGACCTGGGCTAAGGCAAGG + Intergenic
1126782955 15:52154104-52154126 CCAGAACCTGGTCCTTAGCAAGG - Intronic
1127205144 15:56708931-56708953 TCAGGACCTAGGCATGGGCAAGG + Intronic
1127645392 15:60953364-60953386 TCAGGACATAGGCATGAGCAAGG + Intronic
1128416299 15:67449292-67449314 TCAGGACATAGGCATGAGCAAGG - Intronic
1129658819 15:77541879-77541901 CCAGGATCTGGCCTGGAGCTCGG - Intergenic
1130252199 15:82306944-82306966 CCAGTCCCCGGGCTGGAGCAGGG + Intergenic
1131067956 15:89446092-89446114 CCTGGACCAGGGCTGGAGGAAGG + Intergenic
1131096224 15:89655600-89655622 CCAGGCCCAGCCCTTGAGCACGG - Intergenic
1131097068 15:89662971-89662993 CCCAGCCCTGGGCCTGAGCACGG - Intergenic
1132517480 16:372530-372552 CCAGGAACGTGGCTAGAGCAAGG + Intronic
1132865724 16:2091836-2091858 GCAGGAGCTGGGCCTGAGCCTGG - Exonic
1133056494 16:3147938-3147960 CCAGGGCCTGGGCTTGGGCAGGG + Intronic
1134643893 16:15851169-15851191 CCTGGACCAGGCCTTGAGCGAGG - Intronic
1136718698 16:32303340-32303362 CCAGGACCAGGGCTAGGGCCAGG + Intergenic
1136722512 16:32337078-32337100 CCAGGAACAGGGCCAGAGCAAGG + Intergenic
1136773543 16:32859861-32859883 CCAGGACCTGGGCAGGGCCAGGG - Intergenic
1136837069 16:33509604-33509626 CCAGGACCAGGGCTAGGGCCAGG + Intergenic
1136840837 16:33543071-33543093 CCAGGAACAGGGCCAGAGCAAGG + Intergenic
1136897069 16:34001658-34001680 CCAGGACCTGGGCAGGGCCAGGG + Intergenic
1136914341 16:34168515-34168537 TCAGGACATAGGCATGAGCAAGG - Intergenic
1137071999 16:35911944-35911966 CCAGGACCAGGGCCTGGGCGGGG - Intergenic
1137083292 16:36092990-36093012 TCAGGACATGGGCCTGGGCAAGG - Intergenic
1137622714 16:49886766-49886788 CCAGAGCCTGGGCGTGAGCTTGG + Intergenic
1138260823 16:55620581-55620603 CCAGGACATAGGCATGGGCATGG - Intergenic
1139469358 16:67170094-67170116 CCTGGACCCGGGCCTAAGCAAGG - Intergenic
1141657634 16:85424516-85424538 CCTGGCCCTGGGCATGTGCAAGG + Intergenic
1141917430 16:87109200-87109222 GGAGGAACTGGGCTTCAGCAAGG + Intronic
1142111166 16:88332471-88332493 GCTGGCCCTGGCCTTGAGCAAGG + Intergenic
1142159943 16:88552191-88552213 GAAGGAGCTGGGCTTGAGCCCGG - Intergenic
1142193045 16:88726637-88726659 CCAGGAGCTGGGGGAGAGCAGGG + Exonic
1202995620 16_KI270728v1_random:107109-107131 TCAGGACATAGGCATGAGCAAGG + Intergenic
1203003919 16_KI270728v1_random:180686-180708 CCAGGAACAGGGCCAGAGCAAGG - Intergenic
1203007733 16_KI270728v1_random:214431-214453 CCAGGACCAGGGCTAGGGCCAGG - Intergenic
1203022307 16_KI270728v1_random:419451-419473 TCAGGACATAGGCATGAGCAAGG + Intergenic
1203075959 16_KI270728v1_random:1121972-1121994 CCAGGACCTGGGCAGGGCCAGGG - Intergenic
1203123752 16_KI270728v1_random:1559386-1559408 CCAGGACCAGGGCTAGGGCCAGG - Intergenic
1203135527 16_KI270728v1_random:1717093-1717115 CCAGGAACAGGGCCAGAGCAAGG - Intergenic
1203147246 16_KI270728v1_random:1809883-1809905 CCAGGACCAGGGCTAGGGCCAGG + Intergenic
1203151002 16_KI270728v1_random:1843368-1843390 CCAGGAACAGGGCCAGAGCAAGG + Intergenic
1143518201 17:7430380-7430402 CCATGACCAGTGCTGGAGCAGGG - Intergenic
1143723774 17:8831662-8831684 CCAGGCCCTGGGTTTGAACTTGG - Intronic
1143791804 17:9302660-9302682 CCATGACCTGGCTTTGACCAAGG + Intronic
1144078041 17:11736522-11736544 CCAGGACCTGGACGTTATCAAGG + Intronic
1144670625 17:17130712-17130734 CCAGGCCCAGGGCTGGAGCTGGG + Intronic
1144949421 17:18985892-18985914 CCAGGCCCTGGGCTGGGGTAGGG - Intronic
1146307447 17:31741475-31741497 CCAGGTCCTGGGATTAAGGAGGG + Intergenic
1146615777 17:34356401-34356423 AGAGGACCTTGGCCTGAGCAGGG - Intergenic
1147330641 17:39697026-39697048 CCAGGTCCTGGGCTGGATGATGG + Intronic
1148180282 17:45600487-45600509 GCAGGACATGGGCTTCATCAAGG + Intergenic
1148268618 17:46245407-46245429 GCAGGACATGGGCTTCATCAAGG - Intergenic
1150220180 17:63491625-63491647 CCCAGTCCTGGGTTTGAGCATGG + Intronic
1150328168 17:64273458-64273480 CCAGGACTTGGCCTTGAGGAAGG - Intergenic
1151458046 17:74238333-74238355 CCAGGGCCTGGGCCTAAGCGTGG + Intronic
1151727988 17:75895465-75895487 CCAGGCCCTGGGGGTCAGCAGGG - Intronic
1152536046 17:80950890-80950912 GAAGGAGCTGGGCTTCAGCACGG + Intronic
1152555244 17:81049804-81049826 CCAGGACCTTGGCCTGATTAGGG + Intronic
1152620028 17:81358507-81358529 CCAGGCACTGGGCTGGAGCCGGG - Intergenic
1152631894 17:81414204-81414226 GCAGGACCTGTGCTGGGGCAGGG + Intronic
1153887349 18:9478611-9478633 CCACCGCCTGGGCCTGAGCACGG - Intronic
1156493099 18:37507999-37508021 TCTGGACCTGGGCTGGGGCAGGG - Intronic
1157068603 18:44380133-44380155 TCAGGACATAGGCATGAGCAAGG + Intergenic
1158413466 18:57228925-57228947 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1160935620 19:1593121-1593143 CCAAGACTTGGGCTGGAGAAAGG - Intergenic
1161715216 19:5872434-5872456 CCAGAACCTTGGCATGAGCTTGG - Intronic
1162372964 19:10289979-10290001 CGAGGAGCTGGGCTAGAGGACGG - Exonic
1162824764 19:13244668-13244690 CCAGGCCCGGGGCTAGAGGAGGG + Intronic
1162937969 19:13991166-13991188 CCAGGAGCTGGGCAGGAGAAGGG + Intronic
1163216347 19:15880149-15880171 CCAGGATTTTGGTTTGAGCAGGG - Intronic
1163485415 19:17582770-17582792 CCAGGACCTGTGCTTGCCCCTGG - Exonic
1163734698 19:18972539-18972561 GCAGGACCTGGCCTTCAGCGTGG + Intergenic
1164132658 19:22379482-22379504 TCAGGACATGGGCATGGGCAAGG - Intergenic
1164166164 19:22677271-22677293 TCAGGACATGGGCATGGGCAAGG + Intergenic
1164355216 19:27418301-27418323 TCAGGACATAGGCTTGGGCATGG + Intergenic
1164453422 19:28386315-28386337 ACAGGTCGTGGGCATGAGCAAGG + Intergenic
1165245215 19:34494700-34494722 CCAAGACCTGGGCTAGACCCAGG - Intronic
1165389354 19:35529480-35529502 CCAGAACCTGGGCTGGGGCCAGG + Intergenic
1165958316 19:39515584-39515606 CCAGGAGCTGGGCTGGGGCTGGG - Exonic
1166175651 19:41067380-41067402 CCAGGACAGGGGCTTCATCAGGG + Intergenic
1166180594 19:41105116-41105138 TCAGGACATAGGCATGAGCAAGG + Intergenic
1166871224 19:45872288-45872310 CCGGGTCCTGGGCTGGTGCACGG + Exonic
1166898396 19:46038959-46038981 TCAGGACATAGGCATGAGCAAGG - Intergenic
1167353915 19:48992113-48992135 CCAGGGCCTGGGCTCCAGGATGG - Intronic
1167677179 19:50894615-50894637 CTAGGGGCAGGGCTTGAGCAGGG - Intergenic
1168018592 19:53593197-53593219 TCAGGTCATGGGCTGGAGCATGG + Intergenic
1168270624 19:55247795-55247817 CCAGCACCTGGGCTGGAACAAGG + Intronic
1168352448 19:55684413-55684435 CCAGGACTTGAGCCTGAGCTAGG + Intronic
1168686450 19:58352172-58352194 CCTGGACCTGGTCCTGGGCAAGG + Intronic
926134903 2:10329739-10329761 CCAGGATCTGGGCCTGGGCAGGG - Intronic
926152229 2:10431792-10431814 CCAGTAGCTGGGCTGGAGCCGGG + Intergenic
926244976 2:11116414-11116436 CCAGGGCCTGGCCTTGTGCTGGG - Intergenic
926469564 2:13237203-13237225 TCAGGACATAGGCATGAGCAAGG - Intergenic
928631749 2:33200549-33200571 TCAGGACATAGGCTTGGGCAAGG + Intronic
929777208 2:44936947-44936969 CCAGGACTTGGATTTGAGAAAGG - Intergenic
929996253 2:46828016-46828038 AGAGGACCAGGGCTTGAGCGAGG - Intronic
930239234 2:48918824-48918846 TCAGGACATAGGCATGAGCAAGG - Intergenic
931297808 2:60946697-60946719 CCAGGTCCTGGGGTGGGGCAGGG + Intronic
931630418 2:64293486-64293508 CCAAAACTTGGGCTTGTGCAAGG - Intergenic
931736089 2:65195903-65195925 CAAGGAACTGGGCTCCAGCAAGG + Intergenic
931846689 2:66211296-66211318 TCAGGACATGGGCATGGGCAAGG + Intergenic
932089958 2:68797617-68797639 GCAGGACTGGGGCTTGAGCGGGG - Intronic
932662218 2:73665564-73665586 TCAGGACATGGGCATGGGCAAGG - Intergenic
933371302 2:81418911-81418933 CCAGGACCTGGACATTGGCAAGG - Intergenic
933530066 2:83497406-83497428 TCAGGACATAGGCATGAGCAAGG - Intergenic
933690451 2:85175487-85175509 CCTGGTCATAGGCTTGAGCATGG + Intronic
933920447 2:87040313-87040335 CTGGGACCTGGGCTGGTGCAGGG - Intergenic
933931177 2:87153473-87153495 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
933968009 2:87445948-87445970 CCAGGACCTGAGTTGGAGCTTGG + Intergenic
934002550 2:87729585-87729607 CTGGGACCTGGGCTGGTGCAGGG + Intergenic
934250628 2:90351417-90351439 TCAGGACATAGGCGTGAGCAAGG - Intergenic
934258939 2:91451993-91452015 TCAGGACATAGGCGTGAGCAAGG + Intergenic
934302244 2:91783907-91783929 TCAGGACATAGGCATGAGCAAGG + Intergenic
934547096 2:95226875-95226897 CCAGAACCTGGGCATGAACAGGG - Intronic
935630076 2:105206874-105206896 TCAGGACATGGGCATGGGCAAGG - Intergenic
936007728 2:108905801-108905823 CCATAACCTGGGCTTGAGTGTGG - Intronic
936325786 2:111504565-111504587 CCAGGACCTGAGTTGGAGCTTGG - Intergenic
936361946 2:111811959-111811981 CTGGGACCTGGGCTGGTGCAGGG - Intronic
936432031 2:112473218-112473240 CCAGGACCTGGGTTTTGGGATGG - Intergenic
936931709 2:117796645-117796667 TCAGGACATAGGCATGAGCAAGG + Intergenic
937438841 2:121900309-121900331 CCAGGACCTGAGCCTGTGCCTGG + Intergenic
937633350 2:124127983-124128005 TCAGGACATAGGCTTGGGCAAGG + Intronic
937694590 2:124794228-124794250 CCAGAACCTCAACTTGAGCAGGG - Intronic
938082088 2:128375581-128375603 CCAGGACCTGGGCTGGTGTCAGG + Intergenic
938370343 2:130764319-130764341 CCAGGACCTGAGCTGGCTCAGGG + Exonic
939647634 2:144720556-144720578 TCAGGACATAGGCATGAGCAAGG - Intergenic
940913301 2:159228035-159228057 CCAGGATCTGGTCTGGAGAAGGG - Intronic
941075124 2:160998565-160998587 TCAGGACCTAGGCATGGGCAAGG - Intergenic
941546609 2:166858764-166858786 TCAGGACATAGGCATGAGCAAGG + Intergenic
941773696 2:169368943-169368965 CCAGGACGTAGGCATGGGCAAGG + Intergenic
942392322 2:175508509-175508531 TCAGGACATAGGCTTGGGCAAGG + Intergenic
942955455 2:181767700-181767722 TCAGGACATAGGCTTGGGCAAGG - Intergenic
943019955 2:182561124-182561146 TCAGGACATAGGCTTGGGCAAGG - Intergenic
943543964 2:189251684-189251706 CCAGGACATAGGCATGGGCAAGG + Intergenic
943767135 2:191675402-191675424 CCAAAACCTGGGAGTGAGCATGG + Intergenic
943974990 2:194462682-194462704 TCAGGACATGGGCATGGGCAGGG + Intergenic
945380756 2:209137282-209137304 TCAGGACATGGGCATGGGCAAGG - Intergenic
945391141 2:209266443-209266465 TCAGGACATGGGCATGGGCAAGG + Intergenic
946133893 2:217629523-217629545 GCAGGAGCTGGGCTTTGGCATGG + Intronic
946298035 2:218801938-218801960 CCAGGCCCTGGGCTTTGGCTGGG + Intronic
947280055 2:228441587-228441609 TCAGGACATAGGCATGAGCAAGG - Intergenic
947313739 2:228832074-228832096 TCAGGACATAGGCATGAGCAAGG + Intergenic
947876123 2:233469367-233469389 GCAGGACCTGGGCGTGACCAAGG + Exonic
948570793 2:238915904-238915926 CCAGCAGCTGGCATTGAGCAGGG - Intergenic
948942037 2:241201530-241201552 CCATGACCTGGGATTGGGAAGGG + Intronic
1169136295 20:3199875-3199897 CCAGGACCTGCCCTTGTGCCAGG + Intronic
1169213932 20:3783190-3783212 GGAGGGCCTGGGCTTGAGCATGG - Intergenic
1170408236 20:16062178-16062200 CCAGGATCTGTGATTGATCAAGG - Intergenic
1170541346 20:17391601-17391623 CCAAGACCTGGGCTAGTGCTGGG + Intronic
1170926858 20:20732871-20732893 CCAGGGTCTGGCTTTGAGCAAGG + Intergenic
1171075632 20:22120001-22120023 TCAGGACATGGGCATGTGCAAGG + Intergenic
1171076711 20:22134249-22134271 TCAGGACATGGGCATGTGCAAGG + Intergenic
1171432451 20:25091561-25091583 CTTGGACCAGGCCTTGAGCATGG - Intergenic
1172107267 20:32524226-32524248 CCAGCACCAGGGTTTGAGGAAGG - Intronic
1173055661 20:39609996-39610018 CGAGGACATAGGCATGAGCAAGG + Intergenic
1173789301 20:45817408-45817430 CGGGGACCTGGGCTAGAGCCTGG - Intergenic
1174380890 20:50154645-50154667 CCAGGATCGGGGCTGGAACATGG + Intergenic
1174557021 20:51403077-51403099 CCAGGACGTGCGCTTGAGTTGGG - Intronic
1174794239 20:53508789-53508811 TCAGGACATAGGCATGAGCAAGG + Intergenic
1175056371 20:56202387-56202409 CCAGCCCCTGGGCTAGATCAGGG + Intergenic
1175223763 20:57433112-57433134 CCAGGGCCTCGCCTTGAGCTGGG + Intergenic
1175825304 20:61933648-61933670 CCAGGAGCTGGGCCTCCGCAAGG - Intronic
1175825323 20:61933723-61933745 CCAGGAGCTGGGCCTCCGCAAGG - Intronic
1176716123 21:10350736-10350758 TCAGGACCTAGGCGTGGGCAAGG - Intergenic
1176722630 21:10404566-10404588 CCATCACCTAGGCTGGAGCACGG + Intergenic
1176744139 21:10636133-10636155 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1177340833 21:19797641-19797663 CCAGGACATGGGCTTTACAAAGG - Intergenic
1177849438 21:26329082-26329104 CCAGGACATAGGCATGGGCAAGG - Intergenic
1177960781 21:27663351-27663373 TCAGGACATAGGCATGAGCAAGG + Intergenic
1178044885 21:28681974-28681996 TCAGGACATAGGCATGAGCAAGG + Intergenic
1178057362 21:28814304-28814326 TCAGGACATAGGCATGAGCAAGG + Intergenic
1178344717 21:31815298-31815320 TCAGGACATAGGCATGAGCAAGG - Intergenic
1179511210 21:41875080-41875102 AGAGGACCTGGGATTGGGCAGGG - Intronic
1180303809 22:11057315-11057337 CCATCACCTAGGCTGGAGCACGG + Intergenic
1180818814 22:18810811-18810833 ACAGAACCTGGCCTGGAGCATGG + Intergenic
1181205038 22:21245266-21245288 ACAGAACCTGGCCTGGAGCATGG + Intergenic
1181678031 22:24470480-24470502 CCAGGACCTAGAATTGTGCATGG - Intergenic
1181853965 22:25769258-25769280 CCATCACCTGCTCTTGAGCAGGG - Exonic
1182710909 22:32322715-32322737 CCTGCCCCTGGGCTTGTGCATGG + Intergenic
1182886282 22:33776914-33776936 CCAGGTCCAGGGCTGGAGAATGG + Intronic
1183597788 22:38822734-38822756 CCAGGACCTGGGCTGGTGTCAGG + Exonic
1184398450 22:44259584-44259606 CCTGCCCCTGGGCTTGTGCATGG + Intronic
1184718779 22:46297033-46297055 GCCGGGCCTGGGCTCGAGCAGGG + Intronic
1184893976 22:47396494-47396516 CCAGGCCCTGGGCTGGAGCTGGG - Intergenic
1185248509 22:49786640-49786662 CTAGGACCTGGGGTTGAGCCTGG - Intronic
1185264961 22:49896470-49896492 CCAGGACCTGGGCCTGCATAAGG - Intergenic
1203221887 22_KI270731v1_random:50149-50171 ACAGAACCTGGCCTGGAGCATGG - Intergenic
1203268942 22_KI270734v1_random:36664-36686 ACAGAACCTGGCCTGGAGCATGG + Intergenic
950065520 3:10108426-10108448 CCAGGACTTGGCCTTCAGGAGGG + Intergenic
950364220 3:12471700-12471722 CCAGCACCAGGGCTAGAGTAAGG + Intergenic
950410271 3:12831585-12831607 CCAGGGCCTGGGCTAGGGCTGGG - Intronic
950506915 3:13400701-13400723 CCAGGATCTGGGGTGAAGCAGGG + Intronic
950596735 3:13990777-13990799 TCAGGACATAGGCTTGGGCAAGG - Intronic
950604402 3:14065151-14065173 CCAGGGCCTAGGATTGAGCCTGG - Exonic
950636401 3:14318217-14318239 CAGTCACCTGGGCTTGAGCAGGG + Intergenic
951684952 3:25333600-25333622 TCAGGACATAGGCATGAGCAAGG + Intronic
952631784 3:35478439-35478461 TCAGGACATAGGCATGAGCAAGG - Intergenic
953097978 3:39797750-39797772 CCAGGAACAGTGCTTAAGCATGG - Intergenic
953473344 3:43185029-43185051 CCAGGACCAGGGATGGAACAGGG + Intergenic
953749509 3:45598531-45598553 CCAAGACCTGGAATAGAGCATGG - Intronic
953828633 3:46276602-46276624 CCAGGACCTGGAACTGAGCCAGG - Intergenic
954301950 3:49704942-49704964 CCAGGACCAGGGCTGGCTCAGGG - Intronic
954303948 3:49715763-49715785 CCTGGTCCTGGGCTAGAGCCAGG + Intronic
954333591 3:49903651-49903673 CCTGGACCTGGGCGTGGGCCTGG + Intronic
954423859 3:50432939-50432961 CCAGGACCCTGGCCTGAGCCTGG + Intronic
954631142 3:52048220-52048242 CGAGGCCCTGGGCTAGAGCAGGG - Intergenic
955192897 3:56778362-56778384 CCAGGCCCTGGGGTAGGGCATGG - Intronic
955423088 3:58759602-58759624 CCAGGACATAGGCATGGGCAAGG - Intronic
955479763 3:59377592-59377614 CCAGGCACTGGGCTACAGCAGGG + Intergenic
955504604 3:59618875-59618897 TCAGGACCTAGGCATGGGCAAGG + Intergenic
956471851 3:69575422-69575444 TCAGGACATAGGCATGAGCAAGG - Intergenic
956522423 3:70120611-70120633 CAAGGACATTTGCTTGAGCATGG - Intergenic
957267540 3:77986206-77986228 TCAGGACATAGGCTTGGGCAAGG - Intergenic
958184710 3:90106052-90106074 TCAGGACATAGGCATGAGCAAGG - Intergenic
959250320 3:103933547-103933569 TCAGGACATAGGCATGAGCAAGG + Intergenic
959740336 3:109711260-109711282 TCAGGACATGGGCATGGGCAAGG + Intergenic
960941528 3:122938068-122938090 CTGGGATCTGGGCTGGAGCAAGG - Intronic
961651267 3:128417854-128417876 ACAGGACCTGGGGTGCAGCATGG - Intergenic
961997758 3:131264280-131264302 TCAGGACATGGGCATGGGCAAGG - Intronic
962138338 3:132761721-132761743 TCAGGACATGGGCATGGGCAAGG - Intergenic
962294337 3:134167697-134167719 TCAGGACATAGGCATGAGCAAGG + Intronic
962438220 3:135386044-135386066 TCAGGACATAGGCATGAGCAAGG - Intergenic
962713529 3:138107744-138107766 CCAGGACCTGAGCTTGGGCTGGG - Intronic
962923443 3:139971415-139971437 CCAGGCCCTGGGCTTGAGGCTGG + Intronic
963505875 3:146183815-146183837 TCAGGACATAGGCATGAGCAAGG + Intergenic
963902088 3:150742601-150742623 CCAGGACATGGGCAGGAGTAGGG + Exonic
964581085 3:158238790-158238812 CCAGGACATAGGCATGGGCAAGG + Intronic
964651058 3:159011773-159011795 TCAGGACATAGGCATGAGCAAGG - Intronic
964987725 3:162765682-162765704 AGTGAACCTGGGCTTGAGCAAGG - Intergenic
965252137 3:166355516-166355538 TCAGGACATAGGCTTGGGCAAGG + Intergenic
965345897 3:167549761-167549783 TCAGGACATAGGCATGAGCAAGG - Intronic
967405515 3:189112443-189112465 TCAGGACATAGGCTTGGGCAAGG - Intronic
967892689 3:194374180-194374202 CCAGGACCTGGGAATGAGCTGGG - Intergenic
968334280 3:197900220-197900242 CCAGGACCAGGGCTTGCGTAAGG - Intronic
968649029 4:1753153-1753175 CCAGGACCTGGCCATGGACAAGG - Intergenic
968908969 4:3467014-3467036 CCAGAAGCTGGGCAGGAGCAAGG - Intronic
969051091 4:4373569-4373591 CCAGGACCTGGCCTAGTGCAGGG - Intronic
969116902 4:4875992-4876014 CCAGGACCTGGGCTAGTGCTGGG + Intergenic
969175518 4:5395970-5395992 CCAGGCCCTGGGCTTGTCCAAGG + Intronic
969313803 4:6369767-6369789 CCAGACCCTGGGCTACAGCAAGG + Intronic
969626933 4:8310445-8310467 CCAGGCCCTCGGCGTGGGCAGGG - Intergenic
969996458 4:11317565-11317587 CAAGTACCTGGGCTTGGGGAGGG + Intergenic
971744667 4:30564479-30564501 CCATGACATCGGGTTGAGCAAGG + Intergenic
972208203 4:36803570-36803592 TCAGGACTTTGGCATGAGCAAGG - Intergenic
972929274 4:44051197-44051219 TCAGGACATAGGCATGAGCAAGG + Intergenic
973097048 4:46215204-46215226 TCAGGACATGGGCATGGGCAAGG + Intergenic
973098554 4:46232450-46232472 TCAGGACATGGGCATGGGCAAGG - Intergenic
973139891 4:46753636-46753658 TCAGGACATGGGCATGGGCAAGG + Intronic
973315742 4:48758158-48758180 TCAGGACATGGGCATGGGCAAGG + Intronic
973564077 4:52166279-52166301 CCAGGACATAGGCATGGGCAAGG - Intergenic
973586191 4:52394199-52394221 CCAGGACATAGGCATGGGCAAGG + Intergenic
973601087 4:52543410-52543432 CCAGGACATAGGCGTGGGCAAGG + Intergenic
975398752 4:73909331-73909353 TCAGGACATAGGCATGAGCAAGG + Intergenic
976038665 4:80856471-80856493 TCAGGACATGGGCATGGGCAAGG - Intronic
976083884 4:81387523-81387545 TCAGGACATGGGCATGTGCAAGG + Intergenic
976135606 4:81932813-81932835 TCAGGACATAGGCATGAGCAAGG - Intronic
977705110 4:100061884-100061906 AAAGGTCCTGGGCTGGAGCAGGG - Intergenic
978049752 4:104183794-104183816 TCAGGACATAGGCATGAGCAAGG + Intergenic
978242746 4:106536178-106536200 TCAGGACATAGGCATGAGCAAGG - Intergenic
980034167 4:127864598-127864620 CCAGGACATAGGCATGGGCAAGG + Intergenic
980506287 4:133728459-133728481 TCAGGACATAGGCATGAGCAAGG + Intergenic
981937725 4:150253015-150253037 GCAGGACCTGGTCTGGGGCATGG + Intronic
982108345 4:152030689-152030711 CCAGGACCTGCCTTTAAGCACGG - Intergenic
982235747 4:153249617-153249639 CCAGGGCCGGGGCGGGAGCAGGG - Intronic
983894848 4:173070875-173070897 CCAGGTGCTGGTCTGGAGCATGG + Intergenic
985033449 4:185814910-185814932 CAGGGACCTGGGCTAGGGCAGGG - Intronic
985089924 4:186351954-186351976 CCATCACCTGGGCTTGTGAATGG - Intergenic
986380110 5:7175623-7175645 TCAGGACATAGGCATGAGCAAGG + Intergenic
986912707 5:12576381-12576403 TCAGGACATAGGCTTGGGCAAGG + Intergenic
987157020 5:15099000-15099022 CCAGGACATAGGCATGGGCAAGG - Intergenic
987462492 5:18229493-18229515 GCAGGACATAGGCATGAGCAAGG - Intergenic
987529214 5:19095489-19095511 TCAGGACATAGGCATGAGCAAGG - Intergenic
988583753 5:32491133-32491155 CCAGTAGCTGGGCCTGAGGATGG + Intergenic
988770672 5:34429819-34429841 TCAGGACATGGGCATGTGCAAGG - Intergenic
989412496 5:41136556-41136578 TCAGGACATAGGCATGAGCAAGG - Intergenic
989429151 5:41332016-41332038 TCAGGACATAGGCATGAGCAAGG + Intronic
989675757 5:43970343-43970365 TCAGGACATAGGCATGAGCAAGG + Intergenic
989835266 5:45980787-45980809 TCAGGACATAGGCATGAGCAAGG - Intergenic
991088819 5:62673869-62673891 TCAGGACATAGGCATGAGCAAGG - Intergenic
991633573 5:68680824-68680846 CCAGGAGATGGGCCTGGGCATGG - Intergenic
992287583 5:75251052-75251074 TCAGGACTTGGGCATGGGCAAGG - Intergenic
992346669 5:75886086-75886108 CCAGGATGTGGGCTTGACCTTGG + Intergenic
992514060 5:77473367-77473389 TCAGGACATAGGCATGAGCAAGG + Intronic
992700497 5:79336804-79336826 TCAGGACATAGGCCTGAGCAAGG - Intergenic
992803449 5:80314265-80314287 TCAGGACATGGGCATGGGCAAGG - Intergenic
994270189 5:97767687-97767709 TCAGGACCTAGGCATGGGCAAGG - Intergenic
994743857 5:103654742-103654764 CCAGGAACTGGGCTTGACTTTGG - Intergenic
995228595 5:109732430-109732452 TCAGGACATAGGCATGAGCAAGG - Intronic
996252457 5:121353014-121353036 TCAGGACATAGGCATGAGCAAGG + Intergenic
996630506 5:125625852-125625874 TCAGGACATAGGCATGAGCAAGG + Intergenic
997108822 5:131051321-131051343 TCAGGACATGGGCATGGGCAAGG + Intergenic
997271389 5:132541190-132541212 CCAGAACCTGGGATGGTGCAGGG - Intergenic
997387699 5:133486692-133486714 CCAGGAGCTGGGGTTTGGCAGGG - Intronic
997407812 5:133665867-133665889 CCAGGACCAGCCTTTGAGCAAGG - Intergenic
997721455 5:136081010-136081032 CCAGGTCCTGGGCTGGACCCTGG + Intergenic
997870337 5:137500576-137500598 CCAGGACATAGGCGTGGGCAAGG - Intronic
998004582 5:138648654-138648676 GCAGGACCTGGCTTTGAGTAAGG + Intronic
998242188 5:140456780-140456802 TCAGGACATAGGCTTGGGCAAGG + Intronic
998839041 5:146233650-146233672 CCAGGACCTGGACCTGGGCCCGG - Exonic
998862629 5:146459108-146459130 CCTGGGCCTGGGCTTGGGCTTGG - Exonic
999027611 5:148253168-148253190 CCAGGACATAGGCATGGGCAAGG - Intergenic
999195157 5:149776920-149776942 CCAGGAACTGGGCAAGAGCAAGG - Intronic
999418956 5:151424213-151424235 ACAGGACATGGGTTTGAACATGG + Intergenic
1000443618 5:161293476-161293498 CCAGTCCCTTTGCTTGAGCACGG - Exonic
1000775766 5:165417610-165417632 TCAGGACATAGGCATGAGCAAGG + Intergenic
1001111078 5:168896825-168896847 CCAGATCCTGTGCTTGGGCAGGG - Intronic
1001177727 5:169487303-169487325 CCAGGCCCTGGGCATGTCCAGGG - Intergenic
1001332481 5:170772181-170772203 TCAGGACCTGAGCCTGGGCATGG - Intronic
1002052131 5:176577158-176577180 CCCAGACCTGGGCTGGAGCCTGG - Intronic
1003119494 6:3308056-3308078 CCAGGACCTGGGATAGAGGAAGG + Intronic
1003459068 6:6313228-6313250 CCAGGAACTAGGCTTGGACAGGG - Intronic
1003542477 6:7030408-7030430 TCAGGACATAGGCATGAGCAAGG + Intergenic
1005240571 6:23820536-23820558 CCAGGACATAGGCATGGGCAAGG + Intergenic
1005552701 6:26939826-26939848 CCAGGACATAGGCATGGGCAAGG - Intergenic
1005582465 6:27247937-27247959 CCAGGGCCTGGGCCTGAGCCTGG + Exonic
1006061285 6:31421804-31421826 TCAGGAGCTGGGCTTGGACAGGG + Intergenic
1006377995 6:33682458-33682480 CCTGGACCTGGGGTTGCCCAGGG + Intronic
1007636086 6:43300590-43300612 GGAGGACCTGGGCCTGGGCAAGG + Intronic
1007745399 6:44040189-44040211 CCAGGCCCTCGGCTTCTGCACGG + Intergenic
1009956026 6:70454475-70454497 TCAGGACATGGGCATGGGCAAGG - Intronic
1010004340 6:70979211-70979233 TCAGGACATGGGCATGGGCAAGG + Intergenic
1010321241 6:74512815-74512837 TCAGGACATGGGCATGGGCAAGG + Intergenic
1011950322 6:92956927-92956949 CCAGGACATAGGCATGGGCAAGG + Intergenic
1012167227 6:95972278-95972300 TCAGGACATGGGCATGGGCAAGG - Intergenic
1012680642 6:102174608-102174630 TCAGGACATAGGCATGAGCAAGG + Intergenic
1013653338 6:112218937-112218959 CCAGGACATGTGCTCTAGCAGGG - Intronic
1014169938 6:118267478-118267500 CAAGGACCAGGGCTTGGGCCAGG - Intronic
1014304795 6:119727348-119727370 AGAGGAACTGGGGTTGAGCAGGG + Intergenic
1015301592 6:131658732-131658754 CCAGGTTCTGGGCCTTAGCAAGG + Intronic
1015386259 6:132627513-132627535 TCAGGACATAGGCATGAGCAAGG - Intergenic
1016554693 6:145323216-145323238 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1016600652 6:145855041-145855063 TCAGGACATAGGCATGAGCAAGG + Intergenic
1016638627 6:146323659-146323681 TCAGGACATGGGCATGGGCAAGG - Intronic
1016654466 6:146501833-146501855 TCAGGACATAGGCATGAGCAAGG + Intergenic
1016656170 6:146520853-146520875 TCAGGACATAGGCATGAGCAAGG - Intergenic
1016760000 6:147726522-147726544 CCTGGACCTGGGCCTGGGCCTGG - Intronic
1016875381 6:148859561-148859583 TCAGGACCTAGGCATGGGCAAGG - Intronic
1017238312 6:152140114-152140136 CCAGGCCCAGGCATTGAGCAAGG - Exonic
1017623347 6:156321881-156321903 CCAGGACATTGGCCTGGGCAAGG - Intergenic
1017887977 6:158615552-158615574 TCAGGACATGGGCATGGGCAAGG - Intronic
1018148681 6:160918555-160918577 GCAGAGCCTGGGCTTGAGGAAGG - Intergenic
1018208435 6:161456999-161457021 TCAGGACCTGGGTTTGGGCGTGG + Intronic
1018956313 6:168412737-168412759 CCAGGTCTTGAGCTTGAGCCTGG + Intergenic
1019265807 7:116848-116870 CCAGGGCCAGGGGTTGAGCCAGG - Intergenic
1019571759 7:1716161-1716183 GCAGGACCTTGGGGTGAGCAGGG - Intronic
1019908921 7:4086507-4086529 CCAGGAGCTGGGAATGACCATGG - Intronic
1020970514 7:14931934-14931956 GCAAAACCAGGGCTTGAGCAGGG - Intronic
1021479906 7:21104504-21104526 CAAGGACCTGGTTGTGAGCATGG - Intergenic
1021680798 7:23129219-23129241 CCCAGACCTGGGCTTAGGCAAGG + Intronic
1021870102 7:24997334-24997356 TCAGGACATAGGCATGAGCAAGG - Intergenic
1022524331 7:31027737-31027759 CCCAGACCTGGGCCTGCGCAAGG - Intergenic
1022695217 7:32698719-32698741 TCAGGACCTAGGCATGGGCAAGG - Intergenic
1022845633 7:34207005-34207027 CCTGGGCCAGGGCTTGGGCAAGG - Intergenic
1024297674 7:47858816-47858838 CCGAGAACTGGCCTTGAGCAAGG + Exonic
1025071396 7:55902556-55902578 CCAGAGCCTGGGCCTGAACAGGG + Intronic
1025176096 7:56803219-56803241 CCAGGAGCTGGGCAGGAGCTGGG + Intergenic
1025695698 7:63773203-63773225 CCAGGAGCTGGGCAGGAGCTGGG - Intergenic
1025790233 7:64681549-64681571 CCAGACCCTGGGGTTGAGGAAGG - Intronic
1025976942 7:66377294-66377316 CCAGGAGCTGGGCAGGAGCTGGG + Intronic
1026045550 7:66903619-66903641 CCAGGAGCTGGGCAGGAGCTGGG - Intergenic
1027202230 7:76071570-76071592 CCAGGAGCTGGGCAGGAGCTGGG + Intergenic
1027834500 7:83223161-83223183 TCAGGACATAGGCATGAGCAAGG - Intergenic
1029439162 7:100577782-100577804 CCGGGAGCTGGGCTGGACCAGGG - Intronic
1029448794 7:100629218-100629240 CCAGGGCCTGGGCCTGGGCTAGG - Intronic
1030115922 7:106062265-106062287 CCAGGGCCTGAGCCTGGGCAAGG - Intergenic
1030436242 7:109524688-109524710 TCAGGACCTAGGCGTGGGCAAGG - Intergenic
1030853105 7:114515786-114515808 TCAGGACATAGGCATGAGCAAGG - Intronic
1030903313 7:115150928-115150950 ACAGGAGCTGGGGTTGAGTAGGG - Intergenic
1030912752 7:115272455-115272477 CAAAGACCTGGGCTTGCCCAAGG - Intergenic
1030962962 7:115949773-115949795 TCAGGACCTAGGCATGGGCAAGG + Intronic
1031193639 7:118586711-118586733 CCATGACCTGAGCTGCAGCATGG - Intergenic
1031542903 7:123016815-123016837 TCAGGACATCGGCATGAGCAAGG - Intergenic
1031569818 7:123345182-123345204 TCAGGACATAGGCATGAGCAAGG - Intergenic
1031892448 7:127310463-127310485 TCAGGACATAGGCATGAGCAAGG + Intergenic
1032784400 7:135188884-135188906 CCAGAGCCTGGGCTGGGGCAAGG - Intronic
1033647111 7:143313967-143313989 CCAGGGGCTGGGCTGGAGTAGGG - Intergenic
1033705513 7:143882353-143882375 GAAGGCCCGGGGCTTGAGCAGGG - Intronic
1033802674 7:144919428-144919450 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1034438900 7:151076742-151076764 CCAGGCCCTGGGCCTGCGCTGGG - Exonic
1034490050 7:151388395-151388417 CCAGGTTCTGGGCTTGACCTGGG - Intronic
1034941212 7:155231587-155231609 CCAGTACATGGGCATGGGCATGG - Intergenic
1034971785 7:155423901-155423923 CCAGGTGCTGGGCTTGAGAAAGG + Intergenic
1035174472 7:157040370-157040392 GCAGGACCAGGGCTTGGGTAAGG - Intergenic
1037711834 8:21361103-21361125 CCAGGGCCAGGGAGTGAGCAGGG + Intergenic
1037838743 8:22229655-22229677 CCAGGAACTGGGCTGGAGGAAGG - Intronic
1039115598 8:34088511-34088533 CCTGGCCCTTGGCCTGAGCAAGG + Intergenic
1040326795 8:46349678-46349700 TCAGGACATGGGCATGGGCAAGG - Intergenic
1040429253 8:47322018-47322040 TCAGGACATGGGCATGGGCAAGG + Intronic
1040437987 8:47411722-47411744 TCAGGACATGGGCATGGGCAAGG - Intronic
1040456533 8:47603984-47604006 CCAGGACCTGGTCCAGGGCATGG - Intronic
1041314799 8:56550099-56550121 GCAGGACATAGGCATGAGCAAGG - Intergenic
1041760052 8:61356482-61356504 TCAGGACATAGGCATGAGCAAGG - Intronic
1041837083 8:62228517-62228539 TCAGGACATGGGCATGGGCAAGG + Intergenic
1041893296 8:62895962-62895984 CCAGGATCTAGGCTTCAGGATGG - Intronic
1042504855 8:69549145-69549167 CCAGGACTTGGGCTGAGGCATGG - Intronic
1042813011 8:72846334-72846356 CCAGGACATAGGCATGGGCAAGG + Intronic
1043646766 8:82531134-82531156 TCAGGACCTAGGCATGGGCAAGG - Intergenic
1043785104 8:84388910-84388932 TCAGGACATAGGCATGAGCAAGG - Intronic
1044037298 8:87322872-87322894 TCAGGACCTAGGCATGGGCAAGG - Intronic
1044349684 8:91149151-91149173 TCAGGACATGGGCATGGGCAAGG - Intronic
1044353391 8:91192914-91192936 TCAGGACATAGGCTTGGGCAAGG - Intronic
1044457074 8:92401348-92401370 CCAGCTGCTGGGCTTGATCAGGG - Intergenic
1044798484 8:95928955-95928977 TCAGGACATGGGCATGGGCAAGG - Intergenic
1045155093 8:99458987-99459009 TCAGGACATGGGCATGGGCAAGG - Intronic
1045175860 8:99724200-99724222 CCAGGCCCTGGGCTTGCTCTGGG + Intronic
1046425516 8:114043285-114043307 TCAGGACATAGGCATGAGCAAGG - Intergenic
1046616632 8:116484826-116484848 CCTGGGCCTGGCCTAGAGCAGGG - Intergenic
1047129773 8:122006150-122006172 TCAGGACATGGGCATGGGCAAGG + Intergenic
1047840804 8:128749545-128749567 TCAGGACATAGGCATGAGCAAGG + Intergenic
1048075988 8:131071986-131072008 TCAGGACATAGGCATGAGCAAGG - Intergenic
1048092412 8:131255398-131255420 TCAGGACATGGGCATGGGCAAGG + Intergenic
1048164662 8:132051850-132051872 TCAGCACCAGGGCTTGAGAAAGG + Intronic
1048229382 8:132621826-132621848 CCAGAACCTGGGCCTGAGAGAGG - Intronic
1048344902 8:133569164-133569186 CCAGGACCTGGGCTTGAGCAGGG - Intronic
1049164125 8:141116225-141116247 CGAGGACCTGGGCTGATGCAGGG + Intergenic
1051336088 9:16067530-16067552 TCAGGACATGGGCATGGGCAAGG - Intergenic
1051492179 9:17678699-17678721 TCAGGACATGGGCATGGGCAAGG - Intronic
1051817607 9:21128018-21128040 TCAGGACATAGGCATGAGCAAGG + Intergenic
1051987718 9:23110151-23110173 TCAGGACATGGGCATGGGCACGG + Intergenic
1052054960 9:23894957-23894979 TCAGGACATAGGCATGAGCAAGG - Intergenic
1052563190 9:30111803-30111825 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1052586970 9:30441547-30441569 TCAGGACCTAGGCATGGGCAAGG - Intergenic
1053129108 9:35605387-35605409 GCAGGGCCTGGGCTTGGGCCTGG - Exonic
1053571206 9:39309693-39309715 CCAGGACATAGGCATGGGCAAGG + Intergenic
1053837096 9:42150306-42150328 CCAGGACATAGGCATGGGCAAGG + Intergenic
1054092772 9:60868396-60868418 CCAGGACATAGGCATGGGCAAGG + Intergenic
1054114243 9:61144302-61144324 CCAGGACATAGGCATGGGCAAGG + Intergenic
1054125939 9:61309319-61309341 CCAGGACATAGGCATGGGCAAGG - Intergenic
1054593509 9:67038210-67038232 CCAGGACATAGGCATGGGCAAGG - Intergenic
1055323827 9:75107825-75107847 CCAAGACTTCTGCTTGAGCAAGG + Intronic
1055986457 9:82059762-82059784 CCAGGGCCTGGGCTTGCCCTTGG + Intergenic
1056114332 9:83427058-83427080 CCAGGCACAGGGCTTGGGCAGGG + Intronic
1056752540 9:89362952-89362974 GCAGGAACTGGGCTACAGCATGG - Intronic
1057932910 9:99211834-99211856 CCAGGTAGTGTGCTTGAGCATGG + Intergenic
1058218764 9:102269160-102269182 TCAGGTCCTGGGTTTGTGCAGGG + Intergenic
1058696698 9:107564874-107564896 CCAGGGCCTGGACTTGAGCGAGG - Intergenic
1059437641 9:114286111-114286133 CCAGGCCCTGAGCTAGAGGATGG + Intronic
1060088489 9:120722162-120722184 TCATGACCAGGGCTTGAGGAGGG - Intergenic
1060506740 9:124203411-124203433 CCAGCACCTGGGCTTGTGCCTGG + Intergenic
1060510460 9:124228560-124228582 ACAGGCCCTGGCCTTGGGCATGG + Intergenic
1060527695 9:124329734-124329756 ACAGGTCCTGGGCTTTAGCTTGG - Intronic
1060552841 9:124493725-124493747 TCAGGCCCAGGGCATGAGCAGGG + Intronic
1060665865 9:125431837-125431859 GCAGGACCTGGGCCTGCCCATGG + Intergenic
1061407365 9:130399799-130399821 CCAGGAACTGTGCTGGAGCTGGG - Intronic
1062279415 9:135745317-135745339 CCAGGAGCTGGGCGTGGGCTCGG - Intronic
1062709998 9:137970210-137970232 TGAATACCTGGGCTTGAGCATGG - Intronic
1203735433 Un_GL000216v2:134265-134287 TCAGGACATAGGCTTGGGCAAGG - Intergenic
1185855853 X:3534389-3534411 CCAGGGACTGAGCATGAGCATGG - Intergenic
1186177241 X:6937555-6937577 CCAGGACATAGGCATGGGCAAGG + Intergenic
1186720323 X:12296887-12296909 CCAGGACCTGGCCATGCTCATGG + Intronic
1189062942 X:37773673-37773695 TCAGGACATAGGCATGAGCAAGG + Intronic
1189179814 X:38992922-38992944 ACAGAGCCTGGGCCTGAGCAGGG - Intergenic
1189276866 X:39792907-39792929 CCAGTACCTGGCCCTGAGCTGGG + Intergenic
1190601223 X:52094865-52094887 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1190808860 X:53864434-53864456 CTATGGCCTGAGCTTGAGCAGGG + Intergenic
1191216814 X:57941107-57941129 TCAGGACATAGGCATGAGCAAGG - Intergenic
1191266572 X:58400698-58400720 TCAGGACATAGGCATGAGCAAGG + Intergenic
1191738179 X:64409198-64409220 TCAGGACATAGGCATGAGCAAGG + Intergenic
1191758182 X:64617646-64617668 TCAGGACATAGGCTTGGGCAAGG - Intergenic
1191827715 X:65383526-65383548 TCAGGACATAGGCTTGGGCAAGG + Intronic
1191939936 X:66467677-66467699 TCAGGACATAGGCATGAGCAAGG - Intergenic
1192265637 X:69535769-69535791 CCAGGGCCTGGGCCTGGGCCTGG - Intergenic
1192897112 X:75455441-75455463 CCAGGACGTAGGCATGGGCAAGG + Intronic
1193011229 X:76676916-76676938 TCAGGACCTTGGCATGGGCAAGG + Intergenic
1193445296 X:81593924-81593946 TCAGGACATAGGCATGAGCAAGG + Intergenic
1193627960 X:83842991-83843013 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1193704475 X:84804441-84804463 TCAGGACCTAGGCATGGGCAAGG - Intergenic
1193705671 X:84818212-84818234 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1193749231 X:85322517-85322539 TCAGGACCTAGGCATGGGCAAGG + Intronic
1193751837 X:85355381-85355403 TCAGGACATAGGCTTGGGCAAGG + Intronic
1193766453 X:85534139-85534161 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1193771086 X:85588212-85588234 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1193788470 X:85789816-85789838 TCAGGACCTAGGCATGGGCAAGG - Intergenic
1193813134 X:86075265-86075287 TCAGGACCTAGGCATGGGCAAGG - Intergenic
1194648902 X:96491480-96491502 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1194658581 X:96602694-96602716 TCAGGACATAGGCATGAGCAAGG + Intergenic
1194727431 X:97414788-97414810 TCAGGACATGGGCATGGGCAAGG + Intronic
1194899182 X:99486707-99486729 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1195444954 X:104941767-104941789 TCAGGACATGGGCATGGGCAAGG - Intronic
1195733236 X:107987145-107987167 TCAGGACATGGGCATGGGCAAGG - Intergenic
1196592640 X:117505021-117505043 TCAGGACCTAGGCATGGGCAAGG + Intergenic
1196756842 X:119165092-119165114 TCAGGACATAGGCTTGGGCAAGG + Intergenic
1197082776 X:122439668-122439690 ACAGAGCCTGGGCTTGAGCTGGG - Intergenic
1197269512 X:124410444-124410466 TCAGGACATAGGCATGAGCAAGG + Intronic
1197298696 X:124752560-124752582 TCAGGACATAGGCATGAGCAAGG - Intronic
1197396730 X:125936813-125936835 CCAGGACGTAGGCATGGGCAAGG - Intergenic
1197490208 X:127106966-127106988 TCAGGACATAGGCATGAGCAAGG + Intergenic
1198544540 X:137677171-137677193 TCAGGACATAGGCATGAGCAAGG + Intergenic
1198760251 X:140025111-140025133 TCAGGACATAGGCATGAGCAAGG - Intergenic
1198770252 X:140123317-140123339 CCAGGATCTGGGCTGGTGCTGGG + Intergenic
1199424270 X:147682499-147682521 CCAGGCTCTGGGCTTGTGCTGGG - Intergenic
1200211673 X:154349410-154349432 CAAGGGCCTGGGGCTGAGCAAGG - Exonic
1200213636 X:154357854-154357876 CCAGGCCCTGGGGCTGAGGATGG - Intronic
1200334997 X:155341169-155341191 TCAGGACATAGGCATGAGCAAGG - Intergenic
1200351470 X:155500052-155500074 TCAGGACATAGGCATGAGCAAGG + Intronic
1200733600 Y:6770053-6770075 TCAGGACATAGGCTTGGGCAAGG - Intergenic
1200956856 Y:8957921-8957943 TCAGGACATAGGCATGAGCAAGG + Intergenic
1201080420 Y:10239246-10239268 TCAGGACATGGGCATGGGCAAGG - Intergenic
1201278650 Y:12321750-12321772 CCAGGGCCTGGGGTTCAGCCTGG - Intergenic
1201346162 Y:12986969-12986991 TCAGGACATAGGCTTGGGCAAGG - Intergenic
1201606103 Y:15787256-15787278 TCAGGACCTAGGCATGGGCAAGG - Intergenic
1201780283 Y:17713413-17713435 TCAGGACATAGGCATGAGCAAGG + Intergenic
1201821271 Y:18192579-18192601 TCAGGACATAGGCATGAGCAAGG - Intergenic
1202166952 Y:21999614-21999636 TCAGGACATAGGCATGAGCAAGG + Intergenic
1202224408 Y:22586759-22586781 TCAGGACATAGGCATGAGCAAGG - Intergenic
1202318706 Y:23608901-23608923 TCAGGACATAGGCATGAGCAAGG + Intergenic
1202362349 Y:24124423-24124445 CCAGGACATAGGCATGGGCAAGG - Intergenic
1202362724 Y:24128673-24128695 CCAGGACATAGGCATGGGCAAGG + Intergenic
1202388634 Y:24348017-24348039 CTAGTACCAGGGCTTGAGCTGGG + Intergenic
1202482153 Y:25322111-25322133 CTAGTACCAGGGCTTGAGCTGGG - Intergenic
1202508054 Y:25541440-25541462 CCAGGACATAGGCATGGGCAAGG - Intergenic
1202508430 Y:25545690-25545712 CCAGGACATAGGCATGGGCAAGG + Intergenic
1202552062 Y:26061156-26061178 TCAGGACATAGGCATGAGCAAGG - Intergenic
1202625585 Y:56854145-56854167 TCAGGACATAGGCTTGGGCAAGG + Intergenic