ID: 1048344904

View in Genome Browser
Species Human (GRCh38)
Location 8:133569165-133569187
Sequence GCCAGGACCTGGGCTTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048344904_1048344912 28 Left 1048344904 8:133569165-133569187 CCTGCTCAAGCCCAGGTCCTGGC 0: 1
1: 0
2: 4
3: 34
4: 347
Right 1048344912 8:133569216-133569238 TGCCGGCCCAGAAAAATGCAGGG No data
1048344904_1048344910 11 Left 1048344904 8:133569165-133569187 CCTGCTCAAGCCCAGGTCCTGGC 0: 1
1: 0
2: 4
3: 34
4: 347
Right 1048344910 8:133569199-133569221 AGACTCTAAACAGCAAATGCCGG No data
1048344904_1048344911 27 Left 1048344904 8:133569165-133569187 CCTGCTCAAGCCCAGGTCCTGGC 0: 1
1: 0
2: 4
3: 34
4: 347
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048344904 Original CRISPR GCCAGGACCTGGGCTTGAGC AGG (reversed) Intronic
900127472 1:1075013-1075035 GCAAAGACCAGGGCTGGAGCTGG + Intergenic
900205156 1:1428269-1428291 GCCGGGACCTGGGCAGGCGCGGG - Intergenic
900287447 1:1908518-1908540 GGCAGGCCCTGGGCTCGGGCGGG - Intergenic
900592127 1:3464837-3464859 GGCAGGAGCTGGGCCTGAGGAGG - Intronic
900719266 1:4164744-4164766 GCCATGGCCTGGTCCTGAGCTGG - Intergenic
902393589 1:16120086-16120108 CCCAGGCCCTGGGCTGCAGCTGG + Intergenic
902437834 1:16409654-16409676 CCCTGGACCTGGGCTGGAGAAGG - Exonic
902448450 1:16482473-16482495 GCCAGGGCCTGGGCCTGGCCTGG - Intergenic
902448648 1:16483599-16483621 GCCTGGACCTGGCCTGGGGCAGG + Intergenic
902506130 1:16939761-16939783 GCCTGGACCTGGCCTGGGGCAGG - Intronic
903036032 1:20493127-20493149 GCCAGGTCCTGGGCTGGACATGG + Intergenic
903124360 1:21237704-21237726 GCCAGGATCTGAGCTTAGGCCGG + Intronic
903540689 1:24094622-24094644 GCCAGGCCCTGGGTTAGGGCTGG - Intronic
904567028 1:31434321-31434343 TCCAGGACCTGCCCCTGAGCCGG + Exonic
904714866 1:32459901-32459923 GCCAAGAGCTGTGCTTGAGTAGG - Intergenic
905182939 1:36177932-36177954 GCCTGGCCCTGGGCTGGGGCAGG - Exonic
905384892 1:37595751-37595773 GCCTGTACCTGGGTTTGTGCTGG + Exonic
905451169 1:38057558-38057580 GCCAGAACAGGGACTTGAGCAGG - Intergenic
905800648 1:40840115-40840137 GCCAGCACCAGGGCTTGGACTGG + Exonic
905915699 1:41682815-41682837 TCCAGGCCCTGGGCTTGGCCTGG + Intronic
906078163 1:43067353-43067375 GGCAGAACCTGGACTGGAGCTGG - Intergenic
906539418 1:46573641-46573663 GCTAGGACCTAGTCATGAGCCGG - Intronic
907320962 1:53602078-53602100 GCCAGGACTGGGGCTGGGGCTGG - Intronic
907442761 1:54488996-54489018 CCCTGGGCCTGGGTTTGAGCTGG + Intergenic
909326924 1:74363206-74363228 TCCAGGAGCTGGGCTTTAGTGGG + Intronic
913280784 1:117182901-117182923 GTCAGGCCCTGGGCTTCAGTGGG - Intronic
914758470 1:150579788-150579810 GCCGGGGCCGGGGCCTGAGCCGG + Intergenic
915678160 1:157551265-157551287 GCCAGGTCCTGAGCATGAGAGGG - Intronic
915788242 1:158639634-158639656 GCCAGGGACTTGGCTTCAGCAGG - Exonic
915860385 1:159437880-159437902 GGCAGGACCTGAGGCTGAGCAGG - Intergenic
916076180 1:161201155-161201177 ACCAGGACCTGGGCTAGACAAGG - Intronic
916750945 1:167722252-167722274 GCCAGGACCAGGGCTGGGGCCGG + Intronic
918910967 1:190569089-190569111 ACCAGGAACTGGGGGTGAGCTGG - Intergenic
919856956 1:201712601-201712623 GCCAGGATCTGGGGTTCAGAGGG + Intronic
919943457 1:202304050-202304072 ACCAGGAGCTGGGCTGGAGAGGG - Intronic
922569319 1:226624539-226624561 AACAGCACCTGGGCTTGGGCAGG - Intergenic
922584780 1:226725395-226725417 GCCAGGCCCTGGGCTAGGTCTGG - Intronic
924875619 1:248100174-248100196 GCCAGGATCTTGTCTTCAGCTGG - Exonic
1066759381 10:38738649-38738671 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1066759383 10:38738655-38738677 GCCAGGGCCAGGGCCTGGGCAGG - Intergenic
1066962244 10:42234124-42234146 GCCAGGGCCAGGGCCTGGGCAGG + Intergenic
1066962246 10:42234130-42234152 GCCAGGGCCTGGGCAGGACCAGG + Intergenic
1067286172 10:44909006-44909028 GCCAGGACCTGAGCTGGTGATGG + Intergenic
1068556471 10:58464624-58464646 ACCAGGCTCTGGGCTTGTGCTGG + Intergenic
1069544082 10:69316786-69316808 GCCAGGCCCTGCGCTTGTGTAGG + Intronic
1069641600 10:69959586-69959608 GCCTAGATCTGGGCTTGGGCTGG + Intronic
1069833242 10:71293747-71293769 GACAGGCCCTGGGCTCCAGCTGG - Exonic
1069842432 10:71348181-71348203 GCCAGGCCCTGTGCCTGTGCTGG + Intronic
1070382053 10:75890060-75890082 GCCAGTCCTTGGGCCTGAGCTGG - Intronic
1070782848 10:79147525-79147547 GCCAGGACCTGGGCTAGGCAGGG + Intronic
1071032532 10:81202480-81202502 GCCAGCAGCTGAGCTTGGGCTGG + Intergenic
1071463891 10:85922557-85922579 GCCAGGCCCTGGGCTTCACGGGG - Intronic
1071487993 10:86115632-86115654 GTCAGGACCCAGGCTTGAGTTGG - Intronic
1072107927 10:92291434-92291456 CCCTGGGCCTGGCCTTGAGCGGG + Exonic
1074546276 10:114404296-114404318 GCCCGGACCTGGGCCTAAGAGGG - Intronic
1075063176 10:119271130-119271152 ACCAGGACCTGGGGTGGCGCCGG + Intronic
1075204835 10:120437836-120437858 GGAAGGACGTGGCCTTGAGCAGG - Intergenic
1075792939 10:125098495-125098517 GCCAGGACCTGGGGATGAGCGGG + Intronic
1076182210 10:128419039-128419061 GGCAGGAGCTGGGCCTGAGTGGG + Intergenic
1076424187 10:130355661-130355683 GCCAGGACCTGGGGCTCTGCTGG + Intergenic
1076900419 10:133335143-133335165 GCCAGCGCCGGGGCTTGAGGTGG + Intronic
1077151111 11:1073558-1073580 GCCAGGACCTGGGCACGTGGAGG - Intergenic
1077175416 11:1187678-1187700 TCCAGGACCAGGGGTTGTGCTGG - Intronic
1077239521 11:1503252-1503274 GCCAGGCCCTGGCCCTGACCCGG + Intergenic
1077337072 11:2010151-2010173 GCCAGGGCAGGGGCTTGGGCAGG + Intergenic
1077544284 11:3162416-3162438 CTCAGGACCAGGGCTTGAGGTGG - Intronic
1078059425 11:8033652-8033674 GCCAGGCCCTGGGTTGGGGCAGG - Intronic
1078105291 11:8354551-8354573 TCCTAGACCTGTGCTTGAGCTGG - Intergenic
1078454365 11:11463686-11463708 GCCAGGGCCTGGGGTTGGGAGGG - Intronic
1078454923 11:11467519-11467541 GCTGGGACCTGGGCTTGCTCTGG - Intronic
1080651362 11:34225272-34225294 CCCAGGACCAGGGCCAGAGCTGG - Intronic
1080827791 11:35862368-35862390 GCCTGGGCCTGGGCTTGGGCTGG - Intergenic
1081651560 11:44827412-44827434 GCCTGGGCCTGGGCTTGGGTAGG - Intronic
1083669278 11:64291418-64291440 GCCCCGACCTGGGCATCAGCTGG - Intronic
1083691262 11:64410209-64410231 CCCAGGACGTGGGCTGCAGCTGG - Intergenic
1084340057 11:68491987-68492009 GCCAGGGTCTGGGCGGGAGCAGG - Intronic
1084430454 11:69107936-69107958 CCCAGGACACGGGCATGAGCAGG - Intergenic
1084456876 11:69273110-69273132 CCCAGGAGCTGGGCTTGGGTGGG - Intergenic
1084949914 11:72659114-72659136 GCCAGCACGTGGGCTTGGGCAGG - Intronic
1085231219 11:74972548-74972570 GCCAGGCCCTGGGCTGGGTCTGG - Intronic
1085736985 11:79047510-79047532 GCCAGGGACTGGGCTTCTGCGGG + Intronic
1086152735 11:83630298-83630320 ACCAGGACCAGGGCTAGAGTTGG + Intronic
1087138210 11:94740850-94740872 CCGGGGACCTGCGCTTGAGCTGG + Intronic
1087165058 11:94994768-94994790 GGCAGGACCTGGGGTTGGGTGGG + Intronic
1087640993 11:100753500-100753522 GCCAGAACCAGGGGTTGAGTGGG - Intronic
1088815664 11:113419127-113419149 GCCAGAGCCTGGGCCAGAGCAGG - Intronic
1089173658 11:116533481-116533503 GCCTGGACCTGGGGTGGAGGTGG + Intergenic
1089616549 11:119698079-119698101 GGCAGGGCCTGGGCCTGGGCAGG - Intronic
1090346411 11:126075209-126075231 GGCTGGACCAGGGCATGAGCAGG + Intergenic
1090798671 11:130156913-130156935 GCCAAAATCTGGGCTTGAGTTGG + Intergenic
1202820056 11_KI270721v1_random:65333-65355 GCCAGGGCAGGGGCTTGGGCAGG + Intergenic
1094178337 12:27564833-27564855 GCCAGCACCTGGCCTTGACGGGG - Intronic
1094314560 12:29124042-29124064 GCCAGGATCTGGGCTGCAGGGGG - Intergenic
1096543591 12:52322162-52322184 GTGGGGACCTGGGCTTGAGGAGG + Intergenic
1097566091 12:61270071-61270093 GCGAGGAGGTGGGCTTGAGCTGG - Intergenic
1098954079 12:76670454-76670476 TCCAGGAGCTGGGATTGACCTGG + Intergenic
1099450709 12:82803299-82803321 GGCAGGAGCTGGGCTAGAGGAGG + Intronic
1100354188 12:93813699-93813721 GTCATGACATGGGCTTGACCTGG + Intronic
1101529267 12:105559468-105559490 CCCAGGGCCTGCGTTTGAGCTGG + Intergenic
1101740876 12:107499080-107499102 GCCAAGACCTGGGCATGAGAGGG - Intronic
1101827789 12:108233913-108233935 GCCAGGAAGTGGTCTTCAGCTGG - Intronic
1104842224 12:131830589-131830611 GCCGGGATCTGGGCGGGAGCGGG + Intronic
1104956363 12:132468184-132468206 GCCAGGACCAGGGCTGGGGTGGG + Intergenic
1105405094 13:20127100-20127122 CTGAGGACCTGGGCTTCAGCTGG + Intergenic
1105520546 13:21127140-21127162 GCCAGGCCAGGGGCTGGAGCAGG - Intergenic
1110419429 13:75288601-75288623 TGAAGGACCTGGGCTTGAGCTGG - Intronic
1112290644 13:98142516-98142538 GCCAGGACGTGGGCGGGCGCGGG + Intergenic
1113375608 13:109762678-109762700 GGCAGGGCCTGGGCATCAGCTGG - Intronic
1113650234 13:112029259-112029281 AGCAGGACCTGGGCTGGAGTGGG + Intergenic
1113969842 13:114180456-114180478 GCCAGGAAGTGAGGTTGAGCTGG - Intergenic
1113973681 13:114210738-114210760 GGCTGGAGCTGGGCTTGAGCTGG - Intergenic
1115734613 14:36311157-36311179 GTGAGGACTTGGGTTTGAGCAGG + Intronic
1118974313 14:70664173-70664195 GCCAGGACCTGGGGTTGCAGTGG - Intronic
1121013427 14:90534771-90534793 GCAGGGACCTGGGCTGGGGCTGG + Exonic
1121670709 14:95708951-95708973 GCCAGGAACTGGGACTCAGCAGG - Intergenic
1122205553 14:100146286-100146308 GGCAGGACCTGGGCCTGGCCTGG + Exonic
1122838338 14:104442356-104442378 AGCAGGACCTGGGCCTGGGCAGG + Intergenic
1122890209 14:104728776-104728798 GCCAGGCCCTGGGCCAGGGCTGG + Intronic
1123421966 15:20142286-20142308 GTCAGGACCAGGGCTGGACCAGG + Intergenic
1123443211 15:20304670-20304692 GCCAGGACCATGGCTGGGGCAGG - Intergenic
1123531194 15:21148826-21148848 GTCAGGACCAGGGCTGGACCAGG + Intergenic
1124014645 15:25864468-25864490 GCCAGGACCCTGGCTTGGGGAGG + Intronic
1124248937 15:28095100-28095122 GCCTGGACCTGGGCAGGAGGCGG - Intronic
1125321038 15:38488851-38488873 GCCAGGTAGTGGGCTTAAGCAGG + Exonic
1125600376 15:40912380-40912402 GGCAGAACCTGGGGTTAAGCAGG + Intergenic
1125641057 15:41231113-41231135 AGCAGGACTTGGGCTGGAGCTGG + Intronic
1125720993 15:41845098-41845120 GCCAGGGCAAGGGCTGGAGCTGG + Intronic
1127862937 15:63009492-63009514 GCAAAGACCTGGGCCTGGGCAGG - Intergenic
1129091601 15:73157018-73157040 GCCAGGACTGGGGCATGAGAAGG - Intronic
1129125410 15:73436331-73436353 GACAGGACCTGGCCTTGTGTTGG - Intergenic
1129333958 15:74841597-74841619 GGCAGGAACTGGGGTTGTGCAGG - Intronic
1129342913 15:74897799-74897821 GCAAGGAAGGGGGCTTGAGCTGG - Exonic
1129694962 15:77735273-77735295 GCAAGGGCCTGGGCTACAGCAGG + Intronic
1129890112 15:79066343-79066365 GCCAAGCCCAGGGCCTGAGCAGG - Intronic
1130252197 15:82306943-82306965 GCCAGTCCCCGGGCTGGAGCAGG + Intergenic
1132273203 15:100544489-100544511 GCCTCGACCTGGGCCTGCGCGGG + Intronic
1132568832 16:635295-635317 GCAGGGCCCTGGGTTTGAGCAGG + Exonic
1132593290 16:735909-735931 GCCTGGAGCTGGGCTTGGGGAGG - Intronic
1132616887 16:845605-845627 GCCAGGACCCGGGGTGGTGCCGG - Intergenic
1132805379 16:1772864-1772886 GCCAGGACTTGCGCGTGACCAGG + Exonic
1133056492 16:3147937-3147959 TCCAGGGCCTGGGCTTGGGCAGG + Intronic
1133220490 16:4317296-4317318 GCCAAGGCCTGGGCTTGGTCTGG + Intronic
1133938934 16:10292385-10292407 GCCATTGCCTAGGCTTGAGCAGG - Intergenic
1135174787 16:20218307-20218329 GTTAGGAGCTGGGCTAGAGCAGG - Intergenic
1136366367 16:29811002-29811024 GACAAGACCAGGGCTGGAGCTGG - Exonic
1136723400 16:32340508-32340530 GCCAGGGCCAGGGCCTGGGCAGG + Intergenic
1136723402 16:32340514-32340536 GCCAGGGCCTGGGCAGGACCAGG + Intergenic
1136773545 16:32859862-32859884 GCCAGGACCTGGGCAGGGCCAGG - Intergenic
1136841745 16:33546592-33546614 GCCAGGGCCTGGGCAAGACCAGG + Intergenic
1136862570 16:33712383-33712405 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1136897067 16:34001657-34001679 GCCAGGACCTGGGCAGGGCCAGG + Intergenic
1137072001 16:35911945-35911967 ACCAGGACCAGGGCCTGGGCGGG - Intergenic
1138657095 16:58497828-58497850 GCCAGGACCTGGGCAGGGGTGGG + Intronic
1139955603 16:70691620-70691642 GGCAGGACTAGGCCTTGAGCCGG - Intronic
1140862783 16:79033719-79033741 GCCAGGGGCTGGGCTTGGGGAGG - Intronic
1142193043 16:88726636-88726658 GCCAGGAGCTGGGGGAGAGCAGG + Exonic
1142273575 16:89103945-89103967 GAAAGGACCTGGGCTCGAGGCGG + Intronic
1203003030 16_KI270728v1_random:177251-177273 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1203003032 16_KI270728v1_random:177257-177279 GCCAGGGCCAGGGCCTGGGCAGG - Intergenic
1203075961 16_KI270728v1_random:1121973-1121995 GCCAGGACCTGGGCAGGGCCAGG - Intergenic
1203134635 16_KI270728v1_random:1713657-1713679 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1203134637 16_KI270728v1_random:1713663-1713685 GCCAGGGCCAGGGCCTGGGCAGG - Intergenic
1203151910 16_KI270728v1_random:1846889-1846911 GCCAGGGCCTGGGCAAGACCAGG + Intergenic
1142882024 17:2889356-2889378 GCCAGGCCCTGTGCTGGGGCAGG + Intronic
1143119650 17:4598936-4598958 GCCAGGGCCGGGGCTGGGGCCGG - Intronic
1143518032 17:7429787-7429809 GAGTGGACCTGGGCCTGAGCTGG - Intergenic
1143518203 17:7430381-7430403 GCCATGACCAGTGCTGGAGCAGG - Intergenic
1143527200 17:7479546-7479568 GCCAGGGCCGGAGCTGGAGCCGG - Intronic
1143750118 17:9021695-9021717 GCCGGGACCGGGGCTGGGGCTGG + Intronic
1144670623 17:17130711-17130733 ACCAGGCCCAGGGCTGGAGCTGG + Intronic
1146062233 17:29613416-29613438 GCCGGAACCTGGCCCTGAGCTGG - Exonic
1146683676 17:34826296-34826318 GCCAGGAACTGAGCTAGTGCTGG - Intergenic
1147110118 17:38256273-38256295 CCCAGCCCCTGGGCTGGAGCAGG + Intergenic
1148419395 17:47532148-47532170 CCCAGCCCCTGGGCTGGAGCAGG - Intronic
1148549504 17:48542150-48542172 GCGAGGCCTGGGGCTTGAGCCGG - Intronic
1148890187 17:50801564-50801586 GCCAGGAACTGGACTTCAGGTGG + Intergenic
1150251041 17:63704597-63704619 ACCAGGACCTGGGCTGTAGCGGG + Intronic
1150576219 17:66433276-66433298 GCCAGGGCCGGGGCCAGAGCTGG - Intronic
1150576224 17:66433288-66433310 GCCAGGACCAGGGCCAGGGCCGG - Intronic
1151408919 17:73907758-73907780 GCCAGGAGGTGGGCTGGGGCTGG + Intergenic
1151727990 17:75895466-75895488 GCCAGGCCCTGGGGGTCAGCAGG - Intronic
1151784868 17:76270517-76270539 GCCGGGCGCTGGGCTGGAGCTGG + Exonic
1151812575 17:76453086-76453108 GCCGGGGCCTGGGCTGGAGCGGG + Exonic
1152004607 17:77672215-77672237 TCCAGGATCTGGGCATGATCAGG + Intergenic
1152578863 17:81157252-81157274 GCCATGTCCTGGGCTTGTCCCGG - Intronic
1152620030 17:81358508-81358530 GCCAGGCACTGGGCTGGAGCCGG - Intergenic
1152631893 17:81414203-81414225 GGCAGGACCTGTGCTGGGGCAGG + Intronic
1154103629 18:11500176-11500198 GCCAGGACCTGGCATATAGCAGG + Intergenic
1156493100 18:37508000-37508022 GTCTGGACCTGGGCTGGGGCAGG - Intronic
1157824565 18:50801125-50801147 GACAGGTGCTGGGCTTGGGCAGG + Intronic
1159967151 18:74606084-74606106 GCCTGGGCCTGGGCTTGATGTGG + Intronic
1160546536 18:79660670-79660692 CCCAGGACCTGGGCGTGGCCGGG + Intergenic
1161390313 19:4017177-4017199 GCCAAGACCTGGGGCAGAGCTGG - Intronic
1161592688 19:5135865-5135887 GCCAGCACCTGGGCCTGCACTGG - Intronic
1162761974 19:12893784-12893806 GCCAGACCCTGGGCTTCACCTGG + Intronic
1163325374 19:16600080-16600102 GCCTGGGCCTGGGCCTGGGCTGG - Intronic
1163617834 19:18340381-18340403 GCCAGGTGCTGGGGATGAGCCGG - Intergenic
1165046487 19:33108729-33108751 GCCAGGTCCTGGCATAGAGCTGG + Intronic
1165735314 19:38172115-38172137 GGGAGGACGTGGGCCTGAGCTGG + Intronic
1165958318 19:39515585-39515607 GCCAGGAGCTGGGCTGGGGCTGG - Exonic
1166234205 19:41443928-41443950 TCCAGGACCTGGGTGAGAGCAGG - Intronic
1167677180 19:50894616-50894638 GCTAGGGGCAGGGCTTGAGCAGG - Intergenic
1168667420 19:58214923-58214945 GCTGGCACCTGGGCTTGAGGTGG + Intergenic
926134905 2:10329740-10329762 CCCAGGATCTGGGCCTGGGCAGG - Intronic
926142245 2:10374678-10374700 GAAAGGGCCTGGGGTTGAGCTGG + Intronic
926152227 2:10431791-10431813 TCCAGTAGCTGGGCTGGAGCCGG + Intergenic
926244978 2:11116415-11116437 TCCAGGGCCTGGCCTTGTGCTGG - Intergenic
927178689 2:20428380-20428402 GCCTGGAACTGGGCATGAACAGG + Intergenic
927510915 2:23643124-23643146 GCCAGGGCTTGGGCTGGAGGGGG - Intronic
927846166 2:26473849-26473871 GGCAGGCCCTGGGCTGGGGCAGG + Intronic
928163417 2:28950739-28950761 GCCTGGTCCTGGGCAGGAGCGGG + Intergenic
929052806 2:37852482-37852504 GACAGGAACTGGACATGAGCTGG - Intergenic
932089959 2:68797618-68797640 TGCAGGACTGGGGCTTGAGCGGG - Intronic
932331449 2:70900507-70900529 GCCAGGAGCGGGGCCTGAGGAGG + Intergenic
932463664 2:71899174-71899196 GGCAGGACTTGGGCTGGATCTGG + Intergenic
932766756 2:74475297-74475319 GCAGGGGCCTGGGCTTGAGGTGG + Exonic
933920448 2:87040314-87040336 GCTGGGACCTGGGCTGGTGCAGG - Intergenic
933931176 2:87153472-87153494 GCTGGGACCTGGGCTGGTGCAGG + Intergenic
934002549 2:87729584-87729606 GCTGGGACCTGGGCTGGTGCAGG + Intergenic
934547098 2:95226876-95226898 ACCAGAACCTGGGCATGAACAGG - Intronic
934887850 2:98040357-98040379 GCCAGCACCTGGAGTTGACCTGG + Intergenic
935192392 2:100789316-100789338 TCCTGGACCTGGGGTTGAGAAGG - Intergenic
936361947 2:111811960-111811982 GCTGGGACCTGGGCTGGTGCAGG - Intronic
936499936 2:113059118-113059140 GCCAGGACCTGAGGAGGAGCAGG - Exonic
936916082 2:117640294-117640316 GCCAGCACCTGGTATTGATCAGG + Intergenic
937994063 2:127679870-127679892 CCCAGGACCTGGGCTGTGGCAGG - Intronic
938293068 2:130160599-130160621 GCCAGGACCCGGCCTTCACCTGG - Intronic
941937309 2:170994667-170994689 GCCTGGAACTGGGCATGAGGGGG - Intronic
942493810 2:176517909-176517931 GCCATGACCTGGTGGTGAGCTGG - Intergenic
946298033 2:218801937-218801959 GCCAGGCCCTGGGCTTTGGCTGG + Intronic
946329730 2:219002387-219002409 GCCAGGAACTAGGCTGGGGCGGG - Intergenic
947915827 2:233831089-233831111 GGCGGGAGCCGGGCTTGAGCAGG - Intronic
948195061 2:236089389-236089411 GCAAGGACCTCAGCTTGACCTGG - Intronic
948473957 2:238204292-238204314 GCCAGGACTTGGGGTTGGTCTGG + Intergenic
948942035 2:241201529-241201551 GCCATGACCTGGGATTGGGAAGG + Intronic
1168794551 20:602811-602833 GCCAGTCCCTAGGCTGGAGCAGG - Intergenic
1169665759 20:8033650-8033672 CCCAGGAGGTGGGCGTGAGCCGG + Intergenic
1170236144 20:14106618-14106640 GGCAGGACCTGGTGTTGTGCTGG + Intronic
1170541344 20:17391600-17391622 GCCAAGACCTGGGCTAGTGCTGG + Intronic
1170801112 20:19591044-19591066 GTCAGGACCTGGCCTTGAGGGGG - Intronic
1172639582 20:36432665-36432687 GGCAGGATTTGGACTTGAGCAGG - Exonic
1173424733 20:42932689-42932711 GCCAGAGCCTGGGCTGGTGCTGG - Intronic
1174066407 20:47868891-47868913 GCCAGGCCCTGTGCTGGTGCTGG - Intergenic
1174557023 20:51403078-51403100 TCCAGGACGTGCGCTTGAGTTGG - Intronic
1174596534 20:51688677-51688699 GAAAGGGCATGGGCTTGAGCTGG - Intronic
1175056369 20:56202386-56202408 GCCAGCCCCTGGGCTAGATCAGG + Intergenic
1175223761 20:57433111-57433133 CCCAGGGCCTCGCCTTGAGCTGG + Intergenic
1176044141 20:63083733-63083755 GCCCGGACCAGGGCTTCAGGGGG + Intergenic
1176093858 20:63330646-63330668 GCCAGGCGCTGGCCCTGAGCCGG + Intronic
1178180930 21:30160623-30160645 GGCAGAACCTGGGCTTCAGTTGG + Intergenic
1179420983 21:41236643-41236665 TGAAGGACCTGGGCTTCAGCAGG + Intronic
1179511211 21:41875081-41875103 GAGAGGACCTGGGATTGGGCAGG - Intronic
1179577765 21:42318368-42318390 CCCAAGACCTGGGGGTGAGCAGG + Intergenic
1180549463 22:16528904-16528926 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1180549465 22:16528910-16528932 GCCAGGGCCAGGGCCTGGGCAGG - Intergenic
1182549545 22:31093459-31093481 ACCAGGGCCTGGGCCTGAGCTGG + Intronic
1182677159 22:32048314-32048336 GACTGGCCCTGGGCTTGAGCTGG + Intronic
1183015888 22:34986237-34986259 GCCAGGCCCTGGGCTATACCAGG + Intergenic
1183261211 22:36797119-36797141 GCCAGGTTCTGGGATTTAGCAGG + Intergenic
1183708967 22:39491418-39491440 GCCAGGGCCTGGGCATGATCAGG - Exonic
1184218194 22:43081292-43081314 GCCTGTGCCTGGGCTTGTGCTGG - Intronic
1184409952 22:44320686-44320708 GCCTGGACATCGGCTGGAGCTGG - Intergenic
1184860636 22:47171521-47171543 GACAGAGCCTGGGCTTGGGCTGG + Intronic
1184893978 22:47396495-47396517 CCCAGGCCCTGGGCTGGAGCTGG - Intergenic
1184967880 22:47994778-47994800 GGCAGGACCTGGGCTTCAGCAGG + Intergenic
1185172834 22:49303666-49303688 GCCAGGACCTGGGGCAGAGAGGG + Intergenic
1185324738 22:50220114-50220136 GCCAGGACCTGGGCTGCTGTGGG - Intronic
950387334 3:12670518-12670540 GCCAGGCCCTGTGTTAGAGCTGG + Intergenic
950410273 3:12831586-12831608 TCCAGGGCCTGGGCTAGGGCTGG - Intronic
953473342 3:43185028-43185050 GCCAGGACCAGGGATGGAACAGG + Intergenic
954301952 3:49704943-49704965 GCCAGGACCAGGGCTGGCTCAGG - Intronic
954631143 3:52048221-52048243 GCGAGGCCCTGGGCTAGAGCAGG - Intergenic
957262575 3:77920713-77920735 GCTGGGACCTGGGCTGGTGCAGG - Intergenic
962348270 3:134638164-134638186 TCCAGGAACTGGGCCTGGGCTGG + Intronic
962713531 3:138107745-138107767 CCCAGGACCTGAGCTTGGGCTGG - Intronic
962919166 3:139935549-139935571 GCAAGGACCTAGGCTCAAGCTGG + Intronic
962944116 3:140152007-140152029 GCCAGGGGCTGGGCCAGAGCTGG - Intronic
964043945 3:152298720-152298742 GGCAGGACTTGGGCTTTAGAAGG + Intronic
965784882 3:172324981-172325003 GCCAGGGCCTGGGAGTCAGCTGG - Intronic
966871015 3:184290701-184290723 GCCTGGGCCTGTGGTTGAGCTGG + Intronic
967892691 3:194374181-194374203 GCCAGGACCTGGGAATGAGCTGG - Intergenic
968730824 4:2268498-2268520 GTCAGGACCTGGGGATGAGAGGG - Intergenic
969051093 4:4373570-4373592 CCCAGGACCTGGCCTAGTGCAGG - Intronic
969057989 4:4413973-4413995 CCCAGGAGCTGGCCCTGAGCCGG + Intronic
969116900 4:4875991-4876013 CCCAGGACCTGGGCTAGTGCTGG + Intergenic
969506948 4:7594038-7594060 GCCAGGACCTGGGCTAGGTCTGG + Intronic
971267229 4:25106322-25106344 GCCAGGACGTGGCGTTGAGATGG + Intergenic
971376738 4:26061801-26061823 GCCTGGAGCTGGGCCTGGGCTGG + Intergenic
972661418 4:41120303-41120325 GCCAGGTCCTAGGCCTGAGTCGG - Intronic
977705111 4:100061885-100061907 GAAAGGTCCTGGGCTGGAGCAGG - Intergenic
985554618 5:551924-551946 TCCAGGACCCAGGCTTGACCAGG + Intergenic
985682744 5:1265077-1265099 GCCAGGTCCCGCGCCTGAGCAGG - Intronic
986576549 5:9219302-9219324 TGCAGGACCTGGGGTTGAGTGGG + Intronic
994091436 5:95812802-95812824 ACCAGGACCTGGGTTTGAGGCGG + Intronic
994597690 5:101860384-101860406 GCCAGCACGTCGGCTTGAGGAGG + Intergenic
997662887 5:135603138-135603160 GCCAGGATATGGGCCTGGGCTGG - Intergenic
999149133 5:149415147-149415169 GCCAGAACCTGGGTTCAAGCTGG + Intergenic
999249448 5:150173438-150173460 GCCAAGACCTGAGGTTGAGAAGG - Intronic
1002291817 5:178205282-178205304 GCCAGGGCCAGGGCCGGAGCCGG + Intronic
1002309873 5:178307824-178307846 GCCAGGATCTGGGCTGGGCCTGG + Intronic
1003459070 6:6313229-6313251 GCCAGGAACTAGGCTTGGACAGG - Intronic
1006986465 6:38178789-38178811 GCGAGGGCCTGGCCTTAAGCTGG + Intronic
1007716856 6:43861803-43861825 GCCAGAACCTGGCCTTGGGTTGG - Intergenic
1009519722 6:64665934-64665956 GCCAGGAACTTGGATGGAGCTGG + Intronic
1012965694 6:105670247-105670269 ACCAGGTCCTGGGCTGGTGCAGG - Intergenic
1014249386 6:119099960-119099982 GAAAGAACCTGGGCTTGAGATGG + Intronic
1014304794 6:119727347-119727369 GAGAGGAACTGGGGTTGAGCAGG + Intergenic
1017767211 6:157616482-157616504 GCCAGGCCCAAGGCTGGAGCTGG + Intronic
1017796660 6:157850820-157850842 GCCAGGGGCTGGGCCTGTGCTGG + Intronic
1018726199 6:166615072-166615094 GTCGGGACCTGGGCTTCATCCGG - Intronic
1019571760 7:1716162-1716184 GGCAGGACCTTGGGGTGAGCAGG - Intronic
1024415437 7:49099843-49099865 GTCAGGCTCTAGGCTTGAGCTGG - Intergenic
1025176094 7:56803218-56803240 GCCAGGAGCTGGGCAGGAGCTGG + Intergenic
1025695700 7:63773204-63773226 GCCAGGAGCTGGGCAGGAGCTGG - Intergenic
1025912591 7:65840255-65840277 GGCAGGACCTGGGCCTGTCCAGG - Intergenic
1025976940 7:66377293-66377315 GCCAGGAGCTGGGCAGGAGCTGG + Intronic
1026045552 7:66903620-66903642 GCCAGGAGCTGGGCAGGAGCTGG - Intergenic
1026045819 7:66904564-66904586 GGCAGGAGCTGGGCCTGAGGCGG - Intergenic
1026428282 7:70318314-70318336 GCAAGGACGTGGGCTAGAGGAGG + Intronic
1027202228 7:76071569-76071591 GCCAGGAGCTGGGCAGGAGCTGG + Intergenic
1027202956 7:76074357-76074379 GGCAGGAGCTGGGCTTGTGGAGG + Intergenic
1027268078 7:76504882-76504904 GCCAGCACCAGGGGTAGAGCTGG + Intronic
1027430979 7:78112551-78112573 ACCAGGACATGGGATTGCGCAGG - Intronic
1029439164 7:100577783-100577805 GCCGGGAGCTGGGCTGGACCAGG - Intronic
1029577124 7:101411097-101411119 GCCAGGACCTGAGCCCCAGCAGG - Intronic
1030903314 7:115150929-115150951 GACAGGAGCTGGGGTTGAGTAGG - Intergenic
1031994366 7:128219658-128219680 CCCAGGACCTGGGAATGAGCTGG + Intergenic
1031994502 7:128220593-128220615 CCCGGGACCTGGGAATGAGCTGG + Intergenic
1033600050 7:142882885-142882907 GCCAGCACATGGGCTGGAGTGGG + Intronic
1033647113 7:143313968-143313990 GCCAGGGGCTGGGCTGGAGTAGG - Intergenic
1034438902 7:151076743-151076765 TCCAGGCCCTGGGCCTGCGCTGG - Exonic
1034490052 7:151388396-151388418 CCCAGGTTCTGGGCTTGACCTGG - Intronic
1035855886 8:2975869-2975891 TCCAGGAGCTGGGGTTTAGCTGG - Intronic
1037711832 8:21361102-21361124 GCCAGGGCCAGGGAGTGAGCAGG + Intergenic
1038532179 8:28327430-28327452 GCCAGGGCCTGTGCTTGGCCTGG + Intronic
1038618132 8:29114842-29114864 GCCAGGCCCTGGGACTGACCTGG - Intronic
1039117149 8:34104140-34104162 AACTGGACCTGGGCTCGAGCAGG - Intergenic
1040362791 8:46683598-46683620 GCCAGACTCTGGGCTTGTGCTGG + Intergenic
1040482662 8:47841052-47841074 GCCAGGACCTGGCCCTAATCAGG + Intronic
1042224642 8:66505588-66505610 GCCCTGACCTGGGCTTGTGGTGG - Intronic
1042836049 8:73079860-73079882 GCCAGGTGCTGGGCTGGCGCTGG - Intronic
1044138099 8:88611939-88611961 GCCAGGCCCAGCGCTGGAGCTGG - Intergenic
1044457076 8:92401349-92401371 GCCAGCTGCTGGGCTTGATCAGG - Intergenic
1045175858 8:99724199-99724221 GCCAGGCCCTGGGCTTGCTCTGG + Intronic
1048344904 8:133569165-133569187 GCCAGGACCTGGGCTTGAGCAGG - Intronic
1049221571 8:141431079-141431101 GTCAGGACCTTGGCTGGACCTGG + Exonic
1051658963 9:19408701-19408723 GCCAGGAGATGGGCGTGGGCAGG + Intergenic
1052996860 9:34555789-34555811 CCCAGGCTCTGGGCTTGTGCTGG - Intronic
1053143667 9:35697657-35697679 GCCAGGCCCTGGGGTTTGGCAGG + Exonic
1053511075 9:38688170-38688192 GCCAGGGCCCAGGCTTGGGCTGG - Intergenic
1055930949 9:81559395-81559417 GCCACGACCTTTGCTTGAGTGGG - Intergenic
1056592258 9:87973344-87973366 CTCAGGAGCTGGGCTGGAGCTGG + Intronic
1056936008 9:90915089-90915111 GCCAACACCTGGGCATGAGCTGG + Intergenic
1057542681 9:95990171-95990193 GCCAGGAGCCAGGCTGGAGCAGG + Intronic
1057592412 9:96383735-96383757 GTCGGGACCTGGGATTGCGCCGG - Intergenic
1060552840 9:124493724-124493746 GTCAGGCCCAGGGCATGAGCAGG + Intronic
1061320234 9:129823762-129823784 GCTAGGACTAGGGCTGGAGCGGG - Intronic
1061327094 9:129870400-129870422 GCCAGGGCCTGGGCAAGAACAGG - Intronic
1061407367 9:130399800-130399822 GCCAGGAACTGTGCTGGAGCTGG - Intronic
1061742891 9:132720282-132720304 GCCAGGACCTGGGAGTGGGGTGG + Intergenic
1061822845 9:133238340-133238362 GCCAGGAGCTGGCCTGGAGGCGG - Intergenic
1062109715 9:134775279-134775301 GCCAGGCTCTTGGCTTCAGCCGG - Intronic
1062140503 9:134955252-134955274 GCCAGGGCCTGGGCTTGAGGAGG + Intergenic
1062383636 9:136299564-136299586 GCCGTGAGCTGGGCTTGGGCAGG - Intronic
1062722179 9:138050264-138050286 GCGGGGAGCTGGGCTGGAGCTGG + Intronic
1185483123 X:463108-463130 GCCAGGGCCAGGGCTGGAGATGG - Intergenic
1189276864 X:39792906-39792928 TCCAGTACCTGGCCCTGAGCTGG + Intergenic
1191063048 X:56319132-56319154 GCCAGGAACTAAGCTGGAGCTGG - Intergenic
1192210555 X:69125195-69125217 GCAAGGACCTGGCCTAGAGTAGG - Intergenic
1192314908 X:70043886-70043908 GGCTGGACCTGGGCCTGAGTGGG + Intronic
1195037138 X:100980708-100980730 GCCAAGACCTGGTATTGTGCTGG - Intronic
1197082777 X:122439669-122439691 CACAGAGCCTGGGCTTGAGCTGG - Intergenic
1197764157 X:130048817-130048839 GCCAGGGCCTGGGGGAGAGCGGG - Intronic
1198015254 X:132603785-132603807 GCCAGCCCCTGGGGTTCAGCTGG + Intergenic
1198770250 X:140123316-140123338 ACCAGGATCTGGGCTGGTGCTGG + Intergenic
1199298533 X:146186429-146186451 GCCACAACCTGGGCTGGTGCTGG + Intergenic
1199424272 X:147682500-147682522 ACCAGGCTCTGGGCTTGTGCTGG - Intergenic
1200063376 X:153493699-153493721 GCCAGGCCCTGGGCTGCCGCTGG + Intronic
1200126417 X:153816920-153816942 GCCAGGACCTGCTGTTGGGCTGG + Intronic
1200208245 X:154333017-154333039 GGCAGGACCTGGGCTGCACCTGG + Intergenic
1200217457 X:154374379-154374401 GCCCGGACCTGGGCGCGAGCTGG + Intronic
1201190200 Y:11438176-11438198 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1202388633 Y:24348016-24348038 CCTAGTACCAGGGCTTGAGCTGG + Intergenic
1202482154 Y:25322112-25322134 CCTAGTACCAGGGCTTGAGCTGG - Intergenic
1202583431 Y:26403745-26403767 GCCAGGGCCAGGGCCTGGGCAGG + Intergenic
1202583433 Y:26403751-26403773 GCCAGGGCCTGGGCAGGACCAGG + Intergenic