ID: 1048344905

View in Genome Browser
Species Human (GRCh38)
Location 8:133569175-133569197
Sequence ATTGGACAAGGCCAGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048344905_1048344911 17 Left 1048344905 8:133569175-133569197 CCCAGGTCCTGGCCTTGTCCAAT 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data
1048344905_1048344910 1 Left 1048344905 8:133569175-133569197 CCCAGGTCCTGGCCTTGTCCAAT 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1048344910 8:133569199-133569221 AGACTCTAAACAGCAAATGCCGG No data
1048344905_1048344912 18 Left 1048344905 8:133569175-133569197 CCCAGGTCCTGGCCTTGTCCAAT 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1048344912 8:133569216-133569238 TGCCGGCCCAGAAAAATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048344905 Original CRISPR ATTGGACAAGGCCAGGACCT GGG (reversed) Intronic
902549802 1:17212459-17212481 TTTGGACATGGCCAGATCCTGGG - Intronic
902821807 1:18947935-18947957 ATGGGACAAGGCCACCTCCTGGG + Intronic
903235017 1:21944551-21944573 ATTGAACAAAGCCGGGAACTCGG - Intergenic
905148198 1:35904533-35904555 AATGGACAAGGGAAGGACATGGG - Intronic
910572768 1:88724198-88724220 TTAGGACAAGGCCAGAACCCAGG + Intronic
912323892 1:108739674-108739696 ACTTCACTAGGCCAGGACCTGGG - Intronic
915497884 1:156294219-156294241 CCTGGAAAAGGCCTGGACCTAGG + Exonic
916582856 1:166123946-166123968 TTTGGACTAGGCCTGGGCCTGGG - Intronic
918810031 1:189104998-189105020 TTTTGACAAGGCCAAAACCTAGG + Intergenic
923267360 1:232327582-232327604 ATTGGAGAAGGCCAGTGCCCAGG - Intergenic
1067805057 10:49386494-49386516 ATGGGACAAGGCCTGGGCGTAGG + Exonic
1069852223 10:71416371-71416393 CTTGGACAAAGCTAGGACTTTGG + Intronic
1070564224 10:77591220-77591242 ATTGGACAAGGCCACGAGTGAGG + Intronic
1071295574 10:84216983-84217005 CTTGGACAACCCCAGGAACTTGG + Exonic
1072253839 10:93601637-93601659 ATTTGGCATGGCCAGGGCCTGGG - Exonic
1073991566 10:109267686-109267708 ATTGAAGAAGGGCAGGACTTTGG - Intergenic
1075739731 10:124687388-124687410 AGTGGAAAGGGCAAGGACCTGGG + Intronic
1076619971 10:131780824-131780846 GTTGGACAGGGCCAGGATTTAGG - Intergenic
1077452232 11:2655303-2655325 CTTTGTCAAGGCCAGGATCTGGG - Intronic
1079171105 11:18096619-18096641 ATTGAACATTGCCAGGTCCTAGG - Intronic
1079354317 11:19717258-19717280 ATAGGACATGGCCTGGGCCTTGG + Intronic
1079608941 11:22406333-22406355 ATTTTACAAGGTCAGTACCTAGG + Intergenic
1079682794 11:23320011-23320033 ATTGGTCAAAGCCAGCACCAGGG + Intergenic
1079955916 11:26864475-26864497 ATGGGACAAGGGAAGAACCTGGG - Intergenic
1085170937 11:74449342-74449364 ATTGGAACAGGCCAGGACACTGG + Intergenic
1085529215 11:77181733-77181755 GTTGGAGAGGGACAGGACCTGGG - Intronic
1087811295 11:102611619-102611641 ATGGGCCAAGGCCAAGACCATGG - Intronic
1088914610 11:114217975-114217997 ATTTGAGAATGCCAGGAGCTGGG - Intronic
1089211714 11:116808494-116808516 ATTGGCCCAGGGCAAGACCTTGG - Intergenic
1089579817 11:119474658-119474680 AAGGGACAAGGCCAGGGACTGGG + Intergenic
1091422136 12:350914-350936 ATTGGAAAAAGCTAGGATCTCGG - Intronic
1092047393 12:5441725-5441747 ATTTGACAGTGCCAGGAACTTGG + Intronic
1096858736 12:54506874-54506896 AGTGGAGAAGGCTAGGAACTAGG + Intronic
1101424551 12:104576999-104577021 ATTGGAGAATCCCTGGACCTCGG + Intronic
1101898518 12:108773822-108773844 ACTGAGCAAGGCCAGGAGCTGGG - Intergenic
1102678135 12:114672285-114672307 AGGGGACATGGCCAGGCCCTGGG + Exonic
1104229749 12:126873015-126873037 TTTGGAGAAGGACATGACCTGGG + Intergenic
1110357037 13:74578582-74578604 CTTGCATAAGGCCAGGACTTAGG + Intergenic
1113542438 13:111119402-111119424 ATTGCACAATGCCAGGTGCTAGG + Intronic
1121535182 14:94686216-94686238 CTGGGACAAGGCCAGGCCCTGGG + Intergenic
1121783875 14:96640118-96640140 TTTGGACTTGGCCAGGACCAAGG - Intergenic
1124143025 15:27094175-27094197 AATGGAAAAGGCAAGCACCTGGG - Intronic
1125146243 15:36471990-36472012 ATTGGAAAGGGCCAGGAACCAGG - Intergenic
1125749841 15:42020789-42020811 ATTGGACATCCCAAGGACCTGGG - Intronic
1126247413 15:46525356-46525378 ATTGGACAAGGCCAGGCATTAGG - Intergenic
1126375758 15:47995346-47995368 ATTGGAAAAAGCCTGGGCCTTGG + Intergenic
1127699036 15:61479140-61479162 TTTGGACAAGGCCTGAACGTTGG - Intergenic
1132128708 15:99253524-99253546 ATTGGAAAAGCCCAGAAGCTTGG + Intronic
1135400015 16:22160286-22160308 AGTGGGGAAGGACAGGACCTAGG + Intergenic
1136284650 16:29233782-29233804 CTTGGACACGGCCAAGACCCGGG + Intergenic
1137291145 16:47052828-47052850 CTGGCTCAAGGCCAGGACCTGGG - Intergenic
1138247850 16:55480324-55480346 ATTGGTCAAGGGCTGGGCCTCGG + Intronic
1138996125 16:62455033-62455055 ATACGACAAGGGCAGGACCAAGG - Intergenic
1139227814 16:65249988-65250010 ATTGGGGCAGGCCAGGCCCTTGG + Intergenic
1141720703 16:85753749-85753771 ATGGGGCGAGGCCAGGACCTGGG - Intergenic
1144445081 17:15319679-15319701 TTTGTACAAGGACAGGAGCTGGG - Intronic
1145985556 17:29043571-29043593 CTTGGTCAAGGGCAGGAACTGGG - Intronic
1148223669 17:45882992-45883014 ATTGAGCATGGACAGGACCTGGG - Intergenic
1150313768 17:64151209-64151231 ACTGGAAAAGTCCATGACCTGGG + Intronic
1152742822 17:82025832-82025854 CCTGGCCAAGGCCAAGACCTGGG - Intronic
1153781532 18:8499294-8499316 ACTGGACAAGCCCAGGACTCGGG + Intergenic
1157409447 18:47451531-47451553 AGTGGTCAAGCCAAGGACCTGGG - Intergenic
1159655617 18:71028183-71028205 AATGGACAAAGCCAGGGCTTGGG + Intergenic
1160060325 18:75524032-75524054 CATGGGCAAGGCCAGCACCTGGG - Intergenic
1161843728 19:6697836-6697858 AGTGGACAAGGCCAGGCTCCTGG + Intronic
1161994368 19:7703508-7703530 CTTGGACAAGGCCTGGACCTGGG - Intergenic
1162260704 19:9531553-9531575 ATTGGCCAAGACAAGGACATGGG + Intronic
1162533788 19:11251383-11251405 ATTGGCCCAGCCCAGGCCCTTGG - Intronic
1163523763 19:17807938-17807960 AGTGGGCCAGGCCAGGGCCTCGG - Exonic
1164766693 19:30777797-30777819 ATCTGACATGGCCAGAACCTGGG + Intergenic
1167693206 19:50999978-51000000 AGTGGACAAGCCCACTACCTCGG + Exonic
925759858 2:7174153-7174175 ATTGGAGAAGCCAAGGCCCTAGG - Intergenic
929920076 2:46165560-46165582 ATTAGACAAGGCCATCATCTTGG - Intronic
932460927 2:71881386-71881408 ACTGTAAAAGGCGAGGACCTTGG - Intergenic
933423705 2:82084261-82084283 GTGGGACATGGCCAGGAACTGGG - Intergenic
936630617 2:114198909-114198931 ATTGGCCAAGGTAAGGACTTTGG + Intergenic
942352409 2:175065984-175066006 TCTGGACAAGCCCAGGGCCTGGG + Intergenic
943023777 2:182605152-182605174 ATTGGACCAGGGCAGGGCCCAGG - Intergenic
945113916 2:206392374-206392396 ATTGGTCAAGTCCAGGAACACGG + Intergenic
946144001 2:217714952-217714974 CGTGGGCAAGGCCAGGACTTGGG + Intronic
946774670 2:223125041-223125063 CTGGGGCAAGGGCAGGACCTTGG + Intronic
948548994 2:238755172-238755194 ATTGTAAAAGGCCAGCACTTTGG + Intergenic
948592937 2:239063003-239063025 AATGGCCAAGGTCAGGGCCTTGG - Intronic
948636214 2:239339443-239339465 AATGGACAGGGGCAGGAGCTGGG - Intronic
948797469 2:240412267-240412289 AAGGGACAAGGCCAGGCCTTGGG + Intergenic
948852287 2:240714329-240714351 ATGGGACACGGCCAGTGCCTAGG - Exonic
1169572603 20:6923045-6923067 ATTGGACAAAGCAAGTAACTTGG + Intergenic
1170387555 20:15836059-15836081 ATTGCACAATTTCAGGACCTGGG - Intronic
1174266530 20:49335987-49336009 ATTGTGCAAGGTGAGGACCTAGG + Intergenic
1174405266 20:50298820-50298842 ATTGCACAAGGGCTGGGCCTGGG + Intergenic
1174780695 20:53386058-53386080 ACTGGAGAAGGCCAGGCCCTGGG + Intronic
1175404278 20:58716718-58716740 CTCAGACAGGGCCAGGACCTTGG - Intronic
1181315222 22:21966710-21966732 ATTGGCAAGGGCCAGGGCCTGGG - Intronic
1183322420 22:37173115-37173137 ATGGGTCAAGGCCAGGAGGTAGG - Intronic
1183688334 22:39374714-39374736 ATGGGACCAGGACAGGGCCTGGG + Intronic
950096716 3:10334937-10334959 ATTGGAGAAGACCAGAACCAGGG + Intronic
956628383 3:71289730-71289752 ATTGTTCAAGCCCAGGAGCTTGG - Intronic
957514307 3:81231300-81231322 ATTTGACAAGTCCTGGAACTAGG + Intergenic
957773344 3:84722301-84722323 TTTGGGCAAGGCCAGGTCATGGG - Intergenic
961491267 3:127258085-127258107 ACTGGACAAGCTCAGGGCCTGGG - Intergenic
962658294 3:137572151-137572173 ATTGGTCAAAGTCAGGACCAAGG + Intergenic
962928679 3:140017851-140017873 GTTGGGCCATGCCAGGACCTGGG + Intronic
969687041 4:8681499-8681521 AATGGACGAGGCCAGGCTCTAGG + Intergenic
969886461 4:10219762-10219784 CTTGGCCAAGGTCAGGATCTAGG - Intergenic
971301883 4:25448736-25448758 ATTGGGCAGGTTCAGGACCTCGG - Intergenic
971877768 4:32326849-32326871 ATCTGGCAAGGCCAGGGCCTGGG - Intergenic
973801447 4:54482727-54482749 AGTGGTCAAAGACAGGACCTGGG - Intergenic
974091688 4:57317729-57317751 ATTGGACAGGACCAGCACCTGGG - Intergenic
977007897 4:91595101-91595123 ATTGGACATTGGCAGGCCCTGGG - Intronic
978119532 4:105061790-105061812 ATTGCACAAGGCAGGAACCTCGG - Intergenic
978255965 4:106693198-106693220 ATGGGAAAAGGCCTGGACTTGGG + Intergenic
988870614 5:35385150-35385172 CTAGCACAAGGGCAGGACCTTGG - Intergenic
988981297 5:36571852-36571874 TTGGCACAAGGCCAGGAACTGGG - Intergenic
992143654 5:73823636-73823658 ATAGGACAGGGCCAGGAAGTGGG + Intronic
992219717 5:74559984-74560006 ATTGGAAAAGGCCAGGGCTCTGG - Intergenic
994812669 5:104541761-104541783 ATTGGAAAAGCCCAAGATCTGGG + Intergenic
994938672 5:106290657-106290679 ATTGGTGAAGGCCAGGATGTAGG + Intergenic
995531270 5:113094392-113094414 ATTGGAAAAGGCCAGCATTTTGG + Intronic
997641881 5:135454744-135454766 CCTGGACAATGCAAGGACCTTGG - Intergenic
998156937 5:139792393-139792415 ATTGGGCATGGTCAGCACCTTGG - Intergenic
999114629 5:149151802-149151824 GTTGGACAGGCCCAGGAACTAGG - Intronic
999199236 5:149804301-149804323 AAAGGACAAGGCCAGGTGCTTGG + Intronic
999755293 5:154659683-154659705 ATGGGACAAAGCCAGGATGTGGG + Intergenic
1000673517 5:164091879-164091901 ATTGTATAAGGCCAAGACATGGG - Intergenic
1001025314 5:168219258-168219280 ATTGGACATGCACAGCACCTGGG + Intronic
1001162331 5:169331602-169331624 ATTGCACAAGGCCAGAAACATGG + Intergenic
1001699824 5:173698646-173698668 ATTTGACATTCCCAGGACCTGGG + Intergenic
1002297115 5:178237903-178237925 ATAGGACATGGCCTGGACCAGGG - Exonic
1010602564 6:77848582-77848604 GCTGGACTATGCCAGGACCTCGG + Intronic
1015143104 6:129958066-129958088 ATTGGGCAGGGCCAGCTCCTAGG + Intergenic
1015377322 6:132526036-132526058 ATTAGGCAAGGACAGGACCATGG + Intergenic
1017556390 6:155575653-155575675 ATAGGACAATGCAAGGACTTCGG - Intergenic
1017929113 6:158937348-158937370 CTTTGAAAAGGGCAGGACCTAGG + Intergenic
1017987941 6:159460799-159460821 ATTGGAAAAGGACTTGACCTGGG - Intergenic
1018720092 6:166565712-166565734 ACTGGACAGAGCCTGGACCTGGG + Intronic
1019529462 7:1496220-1496242 CATGGACACGGCCAGGACGTCGG + Exonic
1020802897 7:12754419-12754441 ATTTGAAATGGCCAGGACCCAGG + Intergenic
1022345304 7:29508836-29508858 ATTTTACAAGGCAAGGACATTGG - Intronic
1022866348 7:34425472-34425494 ATTGGTCAAGGAGAGGACCCTGG + Intergenic
1026824143 7:73570801-73570823 ACTGGCCAAGGCCAAGACCTGGG + Exonic
1027149115 7:75720005-75720027 ATTAGACAACTCCAGGAACTGGG + Intronic
1032071168 7:128807979-128808001 ATTGGGCAAGAGAAGGACCTAGG + Intronic
1032433819 7:131884022-131884044 AATTGACAAGTTCAGGACCTGGG - Intergenic
1033334318 7:140439339-140439361 TTTGGGCAAGACCATGACCTGGG + Intergenic
1033682139 7:143604918-143604940 AGAGGACAAGGCCAGACCCTGGG - Intergenic
1033702751 7:143856995-143857017 AGAGGACAAGGCCAGACCCTGGG + Intronic
1036693063 8:10956922-10956944 TATGGACAAGGCCAGGACTAGGG - Intronic
1037447774 8:18984811-18984833 AGTGCACAAGGCAAAGACCTTGG + Intronic
1037582668 8:20254849-20254871 ATTGGAGAAGGGCATGAGCTTGG + Exonic
1040490104 8:47912244-47912266 ATTGGTCATGGGCATGACCTGGG - Intronic
1040838649 8:51759862-51759884 ATTGGCCAAGGCAATGCCCTCGG + Intronic
1043733121 8:83710659-83710681 CTTGAAAAAGGCCATGACCTTGG + Intergenic
1044006918 8:86948840-86948862 ATTGGAAAACTCCAGGACGTTGG - Intronic
1044197907 8:89400822-89400844 ATTGGATAAGTCCAGGAACTGGG - Intergenic
1044347059 8:91117631-91117653 ATTGCACAAGTCCAGGATGTGGG + Intronic
1044882313 8:96736120-96736142 ATTGGACAAAGGCAGGGCCAGGG - Intronic
1047061695 8:121234258-121234280 ATTGCATAAGACCAGGGCCTTGG + Intergenic
1047659836 8:127021153-127021175 CTTGCACAATGCCAGGCCCTTGG - Intergenic
1047659851 8:127021276-127021298 CTTGCACAATGCCAGGCCCTTGG - Intergenic
1048344905 8:133569175-133569197 ATTGGACAAGGCCAGGACCTGGG - Intronic
1049587535 8:143438972-143438994 CTTGGCCATGGCCAGGAGCTCGG - Intronic
1051167132 9:14275180-14275202 CGTGGACAAGGCCAGGATCATGG + Intronic
1052234018 9:26188710-26188732 ACTGGAAAGGGCCTGGACCTTGG - Intergenic
1056206457 9:84323900-84323922 ACTGTACAAGGCCTAGACCTTGG - Intronic
1057279881 9:93701725-93701747 GATGGGCAAGGCCAGGCCCTGGG - Intergenic
1057445116 9:95108457-95108479 ATTGGACAAGGGCAGAAAGTCGG - Intronic
1059511604 9:114853100-114853122 AATTGACATGGCCAGGACGTGGG - Intergenic
1060028986 9:120197927-120197949 AGTGGGCAAGGCAGGGACCTGGG + Intergenic
1060196935 9:121629788-121629810 ACTGGAGAAGGTCAGGGCCTCGG + Intronic
1060597495 9:124856988-124857010 AGGGGGCAAGGGCAGGACCTGGG + Intronic
1062026118 9:134341580-134341602 CCTGGCCCAGGCCAGGACCTTGG + Intronic
1185520732 X:736568-736590 CTTGGACATCACCAGGACCTGGG - Intergenic
1189874786 X:45424599-45424621 ATTGTCCAATGCCTGGACCTAGG - Intergenic
1191853578 X:65604680-65604702 ATTGGACAAACCCAGAACCTGGG + Intronic
1192690584 X:73358638-73358660 ATAGGACATGACCAGGACTTTGG + Intergenic
1193573421 X:83172844-83172866 ATTGGACAAGGGGTGGACTTGGG - Intergenic
1194897266 X:99459082-99459104 ATTTGGCAGGGCCAGGACCAGGG + Intergenic
1198834264 X:140784701-140784723 ATTTGAAAAGGCCTGGACCTGGG - Exonic