ID: 1048344906

View in Genome Browser
Species Human (GRCh38)
Location 8:133569176-133569198
Sequence GATTGGACAAGGCCAGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048344906_1048344912 17 Left 1048344906 8:133569176-133569198 CCAGGTCCTGGCCTTGTCCAATC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1048344912 8:133569216-133569238 TGCCGGCCCAGAAAAATGCAGGG No data
1048344906_1048344911 16 Left 1048344906 8:133569176-133569198 CCAGGTCCTGGCCTTGTCCAATC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data
1048344906_1048344910 0 Left 1048344906 8:133569176-133569198 CCAGGTCCTGGCCTTGTCCAATC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1048344910 8:133569199-133569221 AGACTCTAAACAGCAAATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048344906 Original CRISPR GATTGGACAAGGCCAGGACC TGG (reversed) Intronic
901380688 1:8871825-8871847 GACTGGGCAAGGCCAGGAATGGG + Intronic
902628837 1:17692774-17692796 GATGGGTCAGGGCCAGGACTGGG - Intronic
905361467 1:37423619-37423641 GCGTGGGCCAGGCCAGGACCAGG - Intergenic
905364797 1:37444829-37444851 GATGGGACAAGGCCTGGCCCAGG + Intergenic
908677237 1:66619156-66619178 GCTTGGACAAGACAAGGACTAGG - Intronic
912410769 1:109479446-109479468 GCATGGACAGGGCCAGGGCCAGG + Exonic
913330252 1:117661375-117661397 GATTGGAGAAGGCCAGGTGTGGG - Intergenic
915907216 1:159887750-159887772 CACTGGACAAGGCCAGGGACTGG - Intronic
919910230 1:202106591-202106613 GATTGCCCAAGGCCAGCACAGGG + Intergenic
922130078 1:222768999-222769021 TATTGGAGAAGGCAAGGCCCTGG + Intergenic
923957184 1:239035699-239035721 TATTGCACAAGGCCATGAACAGG - Intergenic
1065503010 10:26400289-26400311 GATTGGACAAGGGGAGAAGCTGG + Intergenic
1066961896 10:42232952-42232974 GCTGGGACAGGGCCAGGGCCAGG + Intergenic
1067108005 10:43378303-43378325 AGATGGACAAGGCCAGGCCCTGG + Intergenic
1067451626 10:46385276-46385298 GAGTGGACAGGGCCAGGCCATGG + Intronic
1067581874 10:47451439-47451461 GAATGCACAGGGCCAGGGCCAGG + Intergenic
1067585613 10:47474480-47474502 GAGTGGACAGGGCCAGGCCATGG - Intronic
1072538022 10:96377975-96377997 GATGGGCCCGGGCCAGGACCAGG - Intronic
1074313631 10:112343256-112343278 GATTGCACAAGGTCAGGAGAGGG + Intergenic
1077197572 11:1288992-1289014 GATGGGCCAGGGCCAGGGCCAGG + Intronic
1077216505 11:1397356-1397378 GGTAGAACAAGGCCTGGACCTGG - Intronic
1077300172 11:1843081-1843103 GATGGGACCAGGCAAGGCCCAGG + Intergenic
1077452233 11:2655304-2655326 GCTTTGTCAAGGCCAGGATCTGG - Intronic
1079682793 11:23320010-23320032 AATTGGTCAAAGCCAGCACCAGG + Intergenic
1080086131 11:28284941-28284963 CATTTGGCAAGGGCAGGACCAGG + Intronic
1081675506 11:44966787-44966809 GATTTGAGGAGCCCAGGACCGGG + Intergenic
1083779454 11:64910420-64910442 GATAGGGCAAGGGCATGACCAGG + Intronic
1084408032 11:68990108-68990130 GATTTCACAGGTCCAGGACCAGG + Intergenic
1088914611 11:114217976-114217998 GATTTGAGAATGCCAGGAGCTGG - Intronic
1089391883 11:118107798-118107820 GATTGGCCCAGACCAGGATCTGG + Exonic
1090936576 11:131348382-131348404 GCCTGGACTAGGGCAGGACCTGG - Intergenic
1092516731 12:9222619-9222641 GATTGTTCAAGCCCAGGAGCTGG - Intergenic
1095558885 12:43541936-43541958 GATTTGAATAGGCCAGGACTTGG - Intronic
1096101001 12:48970457-48970479 GACTGCACAACGCCAGGAACAGG + Exonic
1097968098 12:65603040-65603062 AATTTCACAAGGCAAGGACCTGG + Intergenic
1101898519 12:108773823-108773845 GACTGAGCAAGGCCAGGAGCTGG - Intergenic
1102027972 12:109724234-109724256 AGCTGGAAAAGGCCAGGACCTGG - Intronic
1103122826 12:118395190-118395212 GATTCCACAATGCCAGCACCAGG - Intronic
1103860458 12:124008423-124008445 GACTTGACACTGCCAGGACCAGG - Intronic
1106569183 13:30911521-30911543 GATTGGACAAGAGCAGGGGCAGG - Intronic
1107285896 13:38791702-38791724 CATGTGACAAGGGCAGGACCAGG - Intronic
1113113437 13:106848972-106848994 GATTAGGCAAGGCCAGAGCCAGG - Intergenic
1114500706 14:23166247-23166269 GATTGGAAAAAGCCAAGGCCAGG - Intronic
1119765895 14:77187480-77187502 GACTCGGCAAGGCCAGGCCCAGG + Intronic
1120511993 14:85426525-85426547 GGTGGGACTGGGCCAGGACCTGG - Intergenic
1121197551 14:92087559-92087581 GAATGGACAAGGCCAAGATGTGG + Intronic
1121535181 14:94686215-94686237 CCTGGGACAAGGCCAGGCCCTGG + Intergenic
1122352180 14:101102749-101102771 GATTGGACAAGGCCCTGGCCTGG + Intergenic
1123025472 14:105421752-105421774 GATGGGACAAGGCAGGGTCCTGG - Intronic
1124135842 15:27035721-27035743 GATTGGGGAAGGACAGGACGAGG + Intronic
1127399715 15:58573659-58573681 AATTGGACTAGGGCAGGGCCCGG + Intergenic
1128822314 15:70670059-70670081 GATTGGTCACAGCCAGCACCAGG + Intronic
1129646747 15:77442449-77442471 AATTGCACGAGGCCAGGACAAGG - Intronic
1129676199 15:77633433-77633455 GAGGGGACAGGGCCAGGACGGGG - Intronic
1132576659 16:667391-667413 GGTGGGCCAGGGCCAGGACCAGG - Intronic
1132890613 16:2202603-2202625 GATGGGCCAGGGCCAGGGCCAGG + Intergenic
1134668224 16:16035575-16035597 GATTGCTCAAGGCCAGGAGGTGG - Intronic
1136284649 16:29233781-29233803 CCTTGGACACGGCCAAGACCCGG + Intergenic
1136718097 16:32301167-32301189 GCTGGGACAGGGCCAGGGCCAGG + Intergenic
1136723081 16:32339444-32339466 GCTGGGACAGGGCCAGGGCCAGG + Intergenic
1136773880 16:32860979-32861001 GCTGGGACAAGGCCAGTGCCAGG - Intergenic
1136836472 16:33507437-33507459 GCTGGGACAGGGCCAGGGCCAGG + Intergenic
1136836516 16:33507592-33507614 GCTAGGACAGGGTCAGGACCAGG + Intergenic
1136896731 16:34000540-34000562 GCTGGGACAAGGCCAGGGCCAGG + Intergenic
1137762581 16:50952561-50952583 GAAGGGACAAGGCCAGGAGCAGG + Intergenic
1141720704 16:85753750-85753772 CATGGGGCGAGGCCAGGACCTGG - Intergenic
1203003350 16_KI270728v1_random:178320-178342 GCTGGGACAGGGCCAGGGCCAGG - Intergenic
1203008331 16_KI270728v1_random:216598-216620 GCTGGGACAGGGCCAGGGCCAGG - Intergenic
1203076300 16_KI270728v1_random:1123090-1123112 GCTGGGACAAGGCCAGTGCCAGG - Intergenic
1203134958 16_KI270728v1_random:1714727-1714749 GCTGGGACAGGGCCAGGGCCAGG - Intergenic
1142854918 17:2724124-2724146 GGTGGGACCAGGCCAGGATCGGG + Intergenic
1144445082 17:15319680-15319702 GTTTGTACAAGGACAGGAGCTGG - Intronic
1145786105 17:27594871-27594893 GATTGAACAACGCTATGACCTGG + Intronic
1145985557 17:29043572-29043594 GCTTGGTCAAGGGCAGGAACTGG - Intronic
1148223670 17:45882993-45883015 GATTGAGCATGGACAGGACCTGG - Intergenic
1149122914 17:53191283-53191305 CATGTGTCAAGGCCAGGACCAGG - Intergenic
1151508237 17:74543149-74543171 GATGGGACAAGGAGAGGCCCAGG - Intronic
1152778764 17:82217321-82217343 GTGTGGACACGGGCAGGACCAGG + Intergenic
1153781531 18:8499293-8499315 GACTGGACAAGCCCAGGACTCGG + Intergenic
1154305222 18:13225520-13225542 GAGTGGACAGGGCCCAGACCAGG - Intronic
1155360816 18:24999602-24999624 GACTGGACAATGCCAGGTGCTGG + Intergenic
1156394970 18:36691168-36691190 GCATGCAGAAGGCCAGGACCAGG + Intronic
1157500182 18:48185093-48185115 GGTTGGACAGGGCCAGGTGCTGG - Intronic
1160149636 18:76389217-76389239 AACTGGTCAAGGCCAGAACCTGG + Intronic
1161268355 19:3375501-3375523 GATTGGACAGGGCCTGGGCCGGG + Intronic
1161450195 19:4341500-4341522 GATTGCTTAAGGCCAGGACTTGG + Intronic
1161994369 19:7703509-7703531 GCTTGGACAAGGCCTGGACCTGG - Intergenic
1162428589 19:10612801-10612823 TGTTGGACAAGGCCAGGATTGGG - Intronic
1162754117 19:12847177-12847199 CACTGGGCAAGGCCAGGATCAGG - Intronic
1162928237 19:13941407-13941429 GAGTGGCCAAGGCCAGGAGTTGG + Intronic
1163398215 19:17076230-17076252 GAGTGGGCAAGGCCAGGGGCGGG + Intronic
1163583305 19:18150964-18150986 GACTGGACAAGGCCAGGCCAAGG - Exonic
1165881607 19:39047963-39047985 GGGTGGACCAGCCCAGGACCGGG + Intergenic
1167857700 19:52256120-52256142 GATGGGACAAGGAGAGGACTAGG - Intergenic
1168240856 19:55088213-55088235 GTTTGGAGAAGGGCAGGGCCAGG - Intergenic
1168299131 19:55393310-55393332 GACTGGACAGGGCCAGATCCCGG - Intronic
925572817 2:5330134-5330156 GATTGGAGCAGGGCAGGATCTGG + Intergenic
927965786 2:27267200-27267222 GTTTGGACAAGGGCGGGATCAGG - Intronic
928333348 2:30374664-30374686 GATTGGTCATTGCCAGGACCAGG + Intergenic
932412036 2:71553295-71553317 GGTTTGCCAGGGCCAGGACCAGG - Intronic
932417811 2:71584290-71584312 AGGTGGACAAGGCCAGGACAGGG - Intronic
933692450 2:85189864-85189886 GTTTGGAGAAGCCCAGGGCCCGG + Intronic
934323047 2:91984161-91984183 GCTGGGACAAGGCCAGGGCCAGG - Intergenic
937174813 2:119919533-119919555 GAATGAACAAGGCCAGCACGGGG + Intronic
938905499 2:135832325-135832347 GATTGCTCAAGGCCAGGAGTTGG + Intronic
939706140 2:145456341-145456363 GATTGGACAAGGCAAGCAAGAGG - Intergenic
939727157 2:145735650-145735672 TATGGGACAAGGACAGGACTAGG - Intergenic
946013267 2:216583595-216583617 GAGGGGACAGGGCCAGGGCCAGG + Intergenic
947871268 2:233440232-233440254 GACAGGTCAAGGCCAGGAACTGG - Intronic
947873485 2:233452963-233452985 GAGTAGACCAGGCCAGGAACAGG - Intronic
948631098 2:239303167-239303189 GATGGGAACAGGCCAGGGCCAGG - Intronic
948636215 2:239339444-239339466 GAATGGACAGGGGCAGGAGCTGG - Intronic
1168977881 20:1981569-1981591 GATTGGGCACGGGCAGGACCTGG + Intronic
1169053913 20:2604210-2604232 TTTTGAACAAGGCCAGGTCCTGG + Intronic
1173732183 20:45336722-45336744 GACTGGGCAAGACCAGAACCAGG - Intronic
1174358296 20:50012650-50012672 GAATGGACAAAGCCAGGCCGTGG + Intergenic
1174405265 20:50298819-50298841 GATTGCACAAGGGCTGGGCCTGG + Intergenic
1174780694 20:53386057-53386079 CACTGGAGAAGGCCAGGCCCTGG + Intronic
1175612729 20:60365047-60365069 GGCCGGACAAGGCCAGGCCCTGG + Intergenic
1175633194 20:60559343-60559365 GATTGCACAAGGCCAGCCCACGG - Intergenic
1176077497 20:63254941-63254963 GCTTGGAGAAGTCCTGGACCCGG + Intronic
1177386191 21:20412296-20412318 TCTTGAACAAGGTCAGGACCTGG - Intergenic
1178809515 21:35868480-35868502 GATTGGTCATTGCCAGGATCTGG - Intronic
1179787402 21:43737653-43737675 GGCTGGAGAAGGCCAGGGCCAGG + Intronic
1180183522 21:46128488-46128510 GTCTGGAGAAGGCCAGGGCCAGG - Intronic
1180549803 22:16530061-16530083 GCTGGGACAGGGCCAGGGCCAGG - Intergenic
1180703028 22:17791984-17792006 GATTGGACCAGGGCAGGGCGTGG - Intronic
1180743135 22:18067600-18067622 GAGTGGACAAGGGCAGGAGCAGG - Intergenic
1181315223 22:21966711-21966733 GATTGGCAAGGGCCAGGGCCTGG - Intronic
1183006395 22:34906131-34906153 GCTTGGAGAAGGCTATGACCAGG + Intergenic
1183688333 22:39374713-39374735 GATGGGACCAGGACAGGGCCTGG + Intronic
1184914396 22:47559197-47559219 GATTGGACACGGCCAGAGGCCGG + Intergenic
949930921 3:9077807-9077829 GACTGGACAAGGCCAGGTGATGG - Intronic
950096715 3:10334936-10334958 AATTGGAGAAGACCAGAACCAGG + Intronic
953042299 3:39266278-39266300 GATCAGACAAGGCCAGGTTCAGG + Exonic
954782004 3:53068634-53068656 CAGGGGACAGGGCCAGGACCAGG - Intronic
961007222 3:123413178-123413200 GATGGGCCAAGCCAAGGACCAGG + Intronic
962362304 3:134752667-134752689 GAGTGGGCAAAGCCAGGACAAGG + Intronic
962534533 3:136315995-136316017 GATTGCTCAAGGCCAGGAATTGG + Intronic
962928678 3:140017850-140017872 GGTTGGGCCATGCCAGGACCTGG + Intronic
967035597 3:185646494-185646516 CATTGGGAAAGGCCAGCACCTGG - Intronic
969175517 4:5395970-5395992 CCTTGGACAAGCCCAGGGCCTGG - Intronic
971877769 4:32326850-32326872 GATCTGGCAAGGCCAGGGCCTGG - Intergenic
973087510 4:46084493-46084515 GATTGAAAAATGCCAAGACCAGG - Intronic
974091689 4:57317730-57317752 TATTGGACAGGACCAGCACCTGG - Intergenic
975040581 4:69740501-69740523 CATGTGACAAGGGCAGGACCAGG - Intronic
980178415 4:129375199-129375221 GAGTGAACAAGTCCAGGAACTGG + Intergenic
981515128 4:145599436-145599458 GATTGGAAAAGACCAGGAAGAGG - Intergenic
981567812 4:146118938-146118960 GATTTGACTAGGGCAGGACATGG + Intergenic
982987916 4:162233566-162233588 CATTGGTCAAGGGCAGGACCAGG - Intergenic
983022692 4:162699247-162699269 AATGGGTCAAGGGCAGGACCAGG + Intergenic
983525546 4:168757055-168757077 AATTGGACAAGACGAGGTCCTGG + Intronic
985423164 4:189804203-189804225 GATTGCTCAAGGCCAGGTCCTGG - Intergenic
987056255 5:14195834-14195856 GCTTGGAAAAAGACAGGACCAGG - Intronic
987108466 5:14663694-14663716 GTTTGGAGAAGGGCAGGACTTGG - Intergenic
990755382 5:59063596-59063618 GATGGGTCAGGGCCAGGGCCAGG + Intronic
991183507 5:63781816-63781838 GATGTGCCAAGGGCAGGACCAGG - Intergenic
995609441 5:113893370-113893392 GATTGGAAAAGGACAGAACTGGG - Intergenic
995848283 5:116517956-116517978 GATTGGAAAATGCCGTGACCAGG - Intronic
999324370 5:150634348-150634370 GAAAGGACCAGGCCAGGAGCTGG - Intronic
1000673518 5:164091880-164091902 GATTGTATAAGGCCAAGACATGG - Intergenic
1002297116 5:178237904-178237926 GATAGGACATGGCCTGGACCAGG - Exonic
1002348078 5:178561868-178561890 GACTGGAACAGCCCAGGACCGGG + Intronic
1006277125 6:33013932-33013954 GATTGCTCAAGGCCAACACCGGG + Intergenic
1012374188 6:98541173-98541195 GAGTGGAGAAGGCCAGGGCTAGG - Intergenic
1015602486 6:134924026-134924048 GCTTGGACCTGGCCAGGACAAGG + Intronic
1015824926 6:137301284-137301306 GATTGGTCATAGCCAGCACCAGG - Intergenic
1015886654 6:137924933-137924955 TTTTAGACAAGGCCAGGACTAGG + Intergenic
1018390374 6:163336778-163336800 GCTTGGAGAAGGACAGGACTGGG - Intergenic
1019287169 7:229439-229461 CATTGGGCTCGGCCAGGACCTGG - Exonic
1021141685 7:17033536-17033558 GGCTGGACCAGGCCAGGGCCAGG + Intergenic
1026824142 7:73570800-73570822 CACTGGCCAAGGCCAAGACCTGG + Exonic
1026835765 7:73638056-73638078 GATGGGACAAGACCAGACCCTGG - Intergenic
1029536630 7:101161148-101161170 GAAAGGCCAGGGCCAGGACCAGG - Exonic
1033480363 7:141734326-141734348 GTCTGGACAGTGCCAGGACCAGG + Intergenic
1033606187 7:142929885-142929907 GATTGGTAAAAGCCAAGACCAGG + Intronic
1036693064 8:10956923-10956945 TTATGGACAAGGCCAGGACTAGG - Intronic
1037386848 8:18352144-18352166 GGTTGGGCAAGCCCATGACCTGG - Intergenic
1037850372 8:22322638-22322660 GACAGGACAAGGACAGGACAAGG - Intronic
1039465490 8:37782584-37782606 GATTGGACAAGGACAGGCAGGGG + Intergenic
1039945846 8:42128474-42128496 GATGGGCCAAGGGCAGGAACTGG - Intergenic
1040869665 8:52087751-52087773 GCTTGGGCATGGCGAGGACCAGG + Intergenic
1044197908 8:89400823-89400845 AATTGGATAAGTCCAGGAACTGG - Intergenic
1044582462 8:93835783-93835805 TGTAGGACAAGGCAAGGACCAGG - Intergenic
1044882314 8:96736121-96736143 GATTGGACAAAGGCAGGGCCAGG - Intronic
1046737581 8:117793613-117793635 GCTTGGACAAGGCCAGTCCAAGG - Intergenic
1048276363 8:133068927-133068949 GTTTGGCCTAGGCCAGGTCCTGG + Intronic
1048344367 8:133565828-133565850 GATGGGCCAGGGCCAGGGCCAGG + Intronic
1048344906 8:133569176-133569198 GATTGGACAAGGCCAGGACCTGG - Intronic
1052828719 9:33197431-33197453 CAGTGTACAAGGCCAGGACTGGG + Intergenic
1056951261 9:91042598-91042620 GATTGGTCAAGGCAAGGCCCCGG + Intergenic
1056951349 9:91042982-91043004 GATTGGTCAAGGCAAGGCCCCGG - Intergenic
1057190389 9:93083990-93084012 GATGGGACAGGGCCAGGGTCTGG + Intronic
1057757835 9:97852088-97852110 GAGGGGACAAGGACAGGCCCTGG + Intergenic
1058925019 9:109654991-109655013 GATTGGTCAAGGGCAGGGGCCGG + Intronic
1059427640 9:114231151-114231173 GCTTGGACAAGGCCTGAATCGGG - Intronic
1059947863 9:119430405-119430427 GCTTGCTCAAGGCCAGGCCCAGG + Intergenic
1060028985 9:120197926-120197948 GAGTGGGCAAGGCAGGGACCTGG + Intergenic
1060597494 9:124856987-124857009 GAGGGGGCAAGGGCAGGACCTGG + Intronic
1185520733 X:736569-736591 GCTTGGACATCACCAGGACCTGG - Intergenic
1190291666 X:48997149-48997171 GATTGGACAGGGTCTGGCCCTGG - Intronic
1191853577 X:65604679-65604701 AATTGGACAAACCCAGAACCTGG + Intronic
1192585939 X:72318193-72318215 GATTGCTCAAGGCCAGGAGTTGG + Intergenic
1193192779 X:78592520-78592542 TATGTGACAAGGGCAGGACCAGG - Intergenic
1194897265 X:99459081-99459103 CATTTGGCAGGGCCAGGACCAGG + Intergenic
1195986433 X:110635716-110635738 CATTTGTCAAGGGCAGGACCTGG - Intergenic
1196050107 X:111295917-111295939 GATTGGACTGGGGTAGGACCAGG + Exonic
1196650394 X:118162940-118162962 GTTTGAACAAGGATAGGACCTGG - Intergenic
1197137840 X:123083553-123083575 CATTGGGTAAGGCCAAGACCTGG + Intergenic
1197692139 X:129513697-129513719 AATTGGACAATGGAAGGACCAGG - Intronic
1198834265 X:140784702-140784724 GATTTGAAAAGGCCTGGACCTGG - Exonic
1199374151 X:147087907-147087929 GATTGTGTAAGGCCAGGGCCTGG - Intergenic
1200587654 Y:5028684-5028706 GATTGGTCAAGCCCAGGAGTTGG + Intronic
1202583122 Y:26402731-26402753 GCTGGGACAGGGCCAGGGCCAGG + Intergenic