ID: 1048344907

View in Genome Browser
Species Human (GRCh38)
Location 8:133569182-133569204
Sequence GAGTCTGATTGGACAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048344907_1048344910 -6 Left 1048344907 8:133569182-133569204 CCTGGCCTTGTCCAATCAGACTC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1048344910 8:133569199-133569221 AGACTCTAAACAGCAAATGCCGG No data
1048344907_1048344917 27 Left 1048344907 8:133569182-133569204 CCTGGCCTTGTCCAATCAGACTC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1048344917 8:133569232-133569254 TGCAGGGAAAGCAAACTTCAGGG No data
1048344907_1048344912 11 Left 1048344907 8:133569182-133569204 CCTGGCCTTGTCCAATCAGACTC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1048344912 8:133569216-133569238 TGCCGGCCCAGAAAAATGCAGGG No data
1048344907_1048344916 26 Left 1048344907 8:133569182-133569204 CCTGGCCTTGTCCAATCAGACTC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1048344916 8:133569231-133569253 ATGCAGGGAAAGCAAACTTCAGG No data
1048344907_1048344911 10 Left 1048344907 8:133569182-133569204 CCTGGCCTTGTCCAATCAGACTC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048344907 Original CRISPR GAGTCTGATTGGACAAGGCC AGG (reversed) Intronic
901460499 1:9388423-9388445 GAGGCTGAGGGGACAAGGCATGG - Intergenic
903552439 1:24167249-24167271 GAGTCTGAAGGCCCAAGGCCAGG - Intronic
903605732 1:24573873-24573895 GAGTCTGAGTGGACTAGACGGGG + Intronic
903830112 1:26169648-26169670 GATACTGGTTGGACCAGGCCAGG + Intergenic
916058392 1:161083324-161083346 GGGTCTGTTTAGACAAGGACAGG - Intronic
917163619 1:172086301-172086323 CAGTCTGATTGGACGGAGCCTGG + Intronic
922658714 1:227409802-227409824 GAGTCTGAGTGGACGAGGAGGGG - Intergenic
922742526 1:228022023-228022045 AAGTCTGATTTTACAAGGCCAGG - Intronic
923006267 1:230052518-230052540 GAGTTTGATTACACAAGGCAGGG - Intergenic
924539701 1:244970157-244970179 GGGTCTGGAGGGACAAGGCCGGG + Exonic
1064268165 10:13841686-13841708 GAGACATATTGGATAAGGCCTGG - Intronic
1065236690 10:23659470-23659492 GAGTCTGAGTGGGCTAGGCTGGG + Intergenic
1066311071 10:34197311-34197333 GGAACTGATTGGACCAGGCCTGG + Intronic
1066501118 10:35995786-35995808 GCATCTGATTGGCCAAGTCCAGG - Intergenic
1066628986 10:37440045-37440067 GCATCTGATTGGCCAAGTCCAGG - Intergenic
1068892210 10:62159738-62159760 CCAACTGATTGGACAAGGCCTGG - Intergenic
1069490969 10:68860279-68860301 GAGTCTCATTGGTCCAGGCATGG + Intronic
1069828349 10:71267991-71268013 GACTCTGAGTCTACAAGGCCTGG + Intronic
1070969991 10:80555553-80555575 GAGTCTGATTGGTCTAGCTCTGG + Intronic
1075140234 10:119827159-119827181 GAGTGGGCTTGGAAAAGGCCAGG + Exonic
1079148814 11:17879066-17879088 CAGATGGATTGGACAAGGCCTGG + Intronic
1079290905 11:19187023-19187045 GAGTGTGACTGCCCAAGGCCAGG + Intronic
1079839480 11:25377991-25378013 GTGTCTGTTTTGACAAGGTCAGG - Intergenic
1080025714 11:27612284-27612306 AATACTGATTGGAAAAGGCCAGG - Intergenic
1080742983 11:35082860-35082882 GAGTGTGTGTGGACAAGCCCTGG - Intergenic
1082997535 11:59265655-59265677 GACTCTGAAGGGACAAGGCTGGG - Intergenic
1084429717 11:69104487-69104509 GAGTCGGTTTGTACAGGGCCAGG + Intergenic
1084709904 11:70837420-70837442 GAGCGTGAATGCACAAGGCCTGG - Intronic
1086431487 11:86740983-86741005 GAATCTGAGTGGCCAAGGGCAGG - Intergenic
1086490055 11:87350050-87350072 GAGTCTGAGTGGACTAGGTGGGG + Intergenic
1090060258 11:123458433-123458455 GAGTCTGAGTGGACTAGGTGCGG - Intergenic
1091587427 12:1824217-1824239 GAGTTTGATACGACTAGGCCGGG - Intronic
1092324254 12:7512523-7512545 GAGTCTGAGTGGACTAGGTGGGG + Intergenic
1095133114 12:38566926-38566948 GGGACTGATAGGACAAGGGCTGG + Intergenic
1096813521 12:54186780-54186802 GAGGGAGATTGAACAAGGCCTGG - Intronic
1100390829 12:94145403-94145425 GAGTCTGATTGTGGATGGCCTGG + Intergenic
1103940117 12:124496765-124496787 GACTCTGATTGGCCAGGACCGGG - Intronic
1104709620 12:130976465-130976487 GAGTCTCAGTGGACAAGGCCTGG + Intronic
1104915609 12:132262851-132262873 GAGGGTCACTGGACAAGGCCTGG + Intronic
1107181600 13:37467444-37467466 GGGTCTGGTTGGCCAAGGCACGG + Intergenic
1112436876 13:99396788-99396810 GAGTCTGATAGGCCAGGTCCAGG - Intergenic
1114925495 14:27392280-27392302 GAGTGTGAAGGGACAAAGCCTGG + Intergenic
1116632802 14:47356046-47356068 CAGCCTGCATGGACAAGGCCTGG + Intronic
1121595321 14:95157592-95157614 GCCTGTGATTGGACAGGGCCTGG + Intronic
1121689341 14:95864923-95864945 GGGTCTGATTGGAAGAAGCCAGG + Intergenic
1122214960 14:100197087-100197109 GAGTCTGATGAGGCTAGGCCTGG + Intergenic
1124985572 15:34608464-34608486 GATTCTGATTGGCCAAGCCTGGG - Intergenic
1128758402 15:70198474-70198496 AATTCTGGTTGGAAAAGGCCAGG + Intergenic
1130851679 15:87800861-87800883 GTCTCTCATTGGACAAGGCTAGG + Intergenic
1132135088 15:99328641-99328663 GAGTCTGAGTGGACTAGGTAGGG + Intronic
1134400250 16:13903400-13903422 GGGTCTGATTGGCCATGGCTGGG - Intergenic
1135746597 16:25022257-25022279 GAGGCTGACTGGACTAGGACCGG + Intergenic
1137366841 16:47866974-47866996 GAGTCTGAGTGTGCAAGGGCTGG + Intergenic
1139636599 16:68261895-68261917 GAGTCAGGTTGGGCAGGGCCTGG - Intergenic
1141680507 16:85541189-85541211 GAGGCTGATAGGCCAAGGCTGGG + Intergenic
1145735829 17:27231116-27231138 GAGGCTGATTGGCCTAGCCCGGG + Intergenic
1148962740 17:51407031-51407053 GAGTCTGAGTAGACAAGGCTTGG - Intergenic
1149672802 17:58430427-58430449 GAGTCTGAGTGGACTAGGTGGGG + Intronic
1150710702 17:67528746-67528768 GAGTCTGAATGGAGAAGGTCTGG + Intronic
1150796031 17:68237748-68237770 GTGTCTGATTGGACTGAGCCAGG - Intergenic
1151741398 17:75984951-75984973 GAGTCAAATTGGGCAAGGCGCGG + Intronic
1152904509 17:82962969-82962991 GAGGCTGATTGGGAAAAGCCTGG - Intronic
1156063942 18:33117281-33117303 GAAGCTCATTGGACAATGCCAGG - Intronic
1156329304 18:36104524-36104546 GAGTCTGAGTGGACTAGGTAGGG + Intergenic
1157302262 18:46487576-46487598 GATTCTGATTGGGCAGGCCCAGG - Intronic
1157481911 18:48060560-48060582 GAGGCGGAATGGGCAAGGCCAGG - Intronic
1158371063 18:56805050-56805072 GAGTCTGAGTGGACTAGGTGGGG - Intronic
1160136146 18:76273359-76273381 GTGTCTGATTGCACAATTCCGGG + Intergenic
1161935039 19:7366322-7366344 GAGTCTGGTTGGCCAAAGCATGG - Intronic
1162390353 19:10386163-10386185 GAGGCTGTTTTGCCAAGGCCTGG + Intergenic
1163774040 19:19207594-19207616 GAGTGTGATTGTATATGGCCAGG + Intergenic
1165091103 19:33388827-33388849 GCCTGTGAGTGGACAAGGCCAGG - Intronic
1165290812 19:34883870-34883892 GAGTCTGAATGGACTAGGTGGGG + Intergenic
1166551256 19:43667786-43667808 GAATCTGAATGGACGGGGCCTGG - Intronic
1167388471 19:49178656-49178678 GAGTCTGAAGGGACAAGGTGGGG + Intronic
1168667745 19:58217361-58217383 GAGTCTGTTTCCACCAGGCCCGG - Intergenic
925438437 2:3862809-3862831 GAGTCTGAATGGACTAGGTGAGG - Intergenic
925856614 2:8135104-8135126 TAGTGTGTTTGGACAAGGCTGGG + Intergenic
926158120 2:10469330-10469352 GGGTGGGATTGGCCAAGGCCAGG + Intergenic
927477277 2:23423482-23423504 GAATCTGAGAGGACAAGGCACGG - Intronic
928375201 2:30768224-30768246 GAGTCTTATTGGTCAAGCCTGGG - Intronic
929991057 2:46787289-46787311 GAGTCTGAGTGGACTAGGTGGGG + Intergenic
930589751 2:53313046-53313068 GAGTCTGAGTGGACTAGGCAGGG - Intergenic
930932321 2:56901883-56901905 GAGTCTGATTTTAGAAGGACTGG + Intergenic
932397459 2:71457797-71457819 GGGTCTGATAAGCCAAGGCCAGG + Intronic
932717004 2:74108310-74108332 GTGGCAGAATGGACAAGGCCAGG - Intergenic
936590290 2:113797051-113797073 GAGTCTGGGTGGAAATGGCCTGG + Intergenic
939167584 2:138655847-138655869 GAATCTCATGGGACAAGGCTGGG - Intergenic
940642527 2:156361315-156361337 AAGTCTGATGGCACAGGGCCAGG - Intergenic
942595630 2:177589435-177589457 CAGGCTGATTGGACTAGGGCTGG + Intergenic
948002575 2:234580390-234580412 GAGGAGGATGGGACAAGGCCGGG - Intergenic
1171108195 20:22456170-22456192 GGGTATGCTTGGAAAAGGCCAGG + Intergenic
1171497425 20:25565734-25565756 GAGTCTGAGTGGACTAGGTGGGG + Intronic
1172815363 20:37681937-37681959 GAGTCTGATGAGTCAAGGCAGGG + Intergenic
1173088530 20:39948279-39948301 GATTCTGATTGGGCATGGCTTGG + Intergenic
1173759354 20:45546093-45546115 GATTCTGATGGGAAGAGGCCTGG - Intronic
1174315465 20:49697179-49697201 GAGTCTCAGAAGACAAGGCCAGG + Intronic
1175422658 20:58844652-58844674 GAGTCAAATTGGACAACCCCAGG - Intronic
1182765282 22:32753768-32753790 GCTTCTGTTAGGACAAGGCCTGG - Intronic
1182765301 22:32753830-32753852 GCTTCTGTTAGGACAAGGCCTGG - Intronic
1183382426 22:37496828-37496850 AAGTCTGATTGGGCAGGGACTGG - Intronic
1185122136 22:48977651-48977673 AAGCCTGAGTGGACAAAGCCAGG - Intergenic
950631372 3:14284257-14284279 GTGTCTGATTGGCCATGCCCAGG - Intergenic
953537409 3:43786779-43786801 GAGACTGACTGGACCAAGCCTGG + Intergenic
955196446 3:56808802-56808824 GATTGTCAGTGGACAAGGCCAGG + Intronic
956767584 3:72496970-72496992 TGTTCTGATTGGACAATGCCAGG - Intergenic
961466593 3:127085513-127085535 GTGCCTGCTTGGACAAGGCCAGG - Intergenic
963087882 3:141455384-141455406 GAGTCTGATTTGGAAAGACCTGG - Intergenic
965524044 3:169697995-169698017 GCATCTGATTGGTCAAGTCCAGG - Intergenic
965856499 3:173094805-173094827 GAGGCTGACTGGAGATGGCCAGG - Intronic
967093378 3:186154345-186154367 GAATGTAAATGGACAAGGCCAGG + Intronic
970371221 4:15408706-15408728 TAGTCTGATTGGACCAGTTCAGG - Intronic
970466488 4:16328774-16328796 GAGTCTAATGGGAAAAGCCCAGG + Intergenic
970708213 4:18830993-18831015 GAGCCTGAATGGACCTGGCCTGG - Intergenic
971678881 4:29671420-29671442 AAGTCTGAATGGACTAGGCAGGG + Intergenic
972341801 4:38158476-38158498 GAGTATGGTTGGAGAAGGGCTGG - Intergenic
974550479 4:63366267-63366289 GAGTCCGAGTGGGCAAGGCGAGG + Intergenic
977020604 4:91754621-91754643 GAGACTGATTGTACAAGGTATGG - Intergenic
977896388 4:102370198-102370220 GAGTCTGAGTGGACTAGGTGGGG - Intronic
978528218 4:109687948-109687970 GAGTTTGATTTGGCAAGACCTGG - Exonic
981826165 4:148944002-148944024 CAGCCTGATTGAATAAGGCCTGG - Intergenic
982402745 4:154986095-154986117 GAGTCTGAGTGGACTAGGTAGGG + Intergenic
983432602 4:167670648-167670670 GAGTCTGAGTGGACGAGGTGGGG - Intergenic
985384313 4:189429351-189429373 GAGTCTGAGTGCACCAGGCAAGG + Intergenic
985649784 5:1102100-1102122 CAGCCTGGTTGGACAAGCCCAGG - Intronic
985798170 5:1980395-1980417 GAGTCTGATTGTCCAAGGGCAGG - Intergenic
988582672 5:32481885-32481907 GAGTCTGAGTGGACAAGGTGGGG + Intergenic
989377584 5:40780822-40780844 GAGTCTGAGTGGACTAGGTGGGG - Intronic
990035522 5:51313277-51313299 GTGTATGATTTGAAAAGGCCGGG + Intergenic
990505822 5:56444087-56444109 GAGTCTGATTGGTTGAGCCCAGG + Intergenic
992268975 5:75046587-75046609 CAGGCTGACTGGACAAGCCCGGG + Intergenic
997101675 5:130976071-130976093 GATTCTGACTTTACAAGGCCAGG - Intergenic
999814880 5:155166043-155166065 GTGTCTGATTGATCAAGCCCAGG + Intergenic
1000127699 5:158263167-158263189 GAGTCTCTTTGTACAAGGCCTGG + Intergenic
1000282860 5:159797273-159797295 GAATCTGATTGGACAGGCCCAGG + Intergenic
1000533484 5:162452855-162452877 CAGTCTGGTTGGATAGGGCCTGG + Intergenic
1006560928 6:34911496-34911518 CAGTGTGATTGAAGAAGGCCTGG - Intronic
1006979237 6:38133452-38133474 GAGCATTGTTGGACAAGGCCGGG + Intronic
1007735206 6:43978031-43978053 GAGTCTGAGTGGACTAGGTGGGG - Intergenic
1008343464 6:50396477-50396499 GAGTCTGCTTGGGCAATGCACGG - Intergenic
1008381804 6:50845639-50845661 TGTTCTGATTGCACAAGGCCAGG + Exonic
1011422169 6:87184981-87185003 GAGTCTGAGTGGACTAGGTAGGG - Intronic
1013304163 6:108832764-108832786 GTGTCTGATTGGAGGAGTCCAGG - Intergenic
1013589862 6:111610864-111610886 GAGTCTGAGTGGACTAGGTGGGG - Intergenic
1013841268 6:114397277-114397299 GAATCTGAGTGGACTAGGCAGGG - Intergenic
1016028058 6:139309046-139309068 GAGTGTGGTTGGACAAGGCTAGG - Intergenic
1016407142 6:143742555-143742577 GGCTCTGATTGGATAAGCCCAGG + Intronic
1016414607 6:143819775-143819797 GAGTCTGAGTGGACTAGGTAGGG - Intronic
1022514201 7:30965123-30965145 GAATCTGATTTGTCAAGGGCTGG + Intronic
1023140159 7:37094168-37094190 GAGACTGCTTTGACAATGCCAGG + Intronic
1023600061 7:41873880-41873902 TAGTCGGTTTGGACAAGGGCAGG - Intergenic
1031276580 7:119731813-119731835 GAGTCTGAGTGGATTAGGTCAGG - Intergenic
1032490293 7:132319247-132319269 GAGTCTCAGTGGACAGGGCCTGG - Intronic
1035432611 7:158833637-158833659 GAAACTGAATGGCCAAGGCCAGG + Intergenic
1037598097 8:20371223-20371245 GAGTCTGATTGGAAAGAGCAAGG - Intergenic
1037610107 8:20468930-20468952 GAGGCTGAGTGTAAAAGGCCTGG - Intergenic
1038538890 8:28374832-28374854 AAGTGTGATTGGGCAAGGGCTGG - Intronic
1048344907 8:133569182-133569204 GAGTCTGATTGGACAAGGCCAGG - Intronic
1049802868 8:144526372-144526394 GAGGCTGAGTGGGCCAGGCCTGG - Exonic
1049870397 8:144970579-144970601 GAGGCTGATTGGGCTAGGACAGG - Intergenic
1050021961 9:1293635-1293657 GAGGTTGAGTGGACAAGGCATGG - Intergenic
1050301366 9:4262074-4262096 GAGACTGTTTGGACTAGACCGGG - Intronic
1051639086 9:19207671-19207693 GAGGCTGATTGCTTAAGGCCAGG - Intergenic
1057586111 9:96330257-96330279 GAGTCTGAGTGGACCAGGTGGGG - Intronic
1057931577 9:99198079-99198101 GAGTCTGATTGGCTGAGCCCAGG - Intergenic
1058503469 9:105646349-105646371 GAGTGTGATAGGACAAGGCAGGG + Intergenic
1059619073 9:115983520-115983542 GATTTCGATTGGGCAAGGCCTGG - Intergenic
1060592451 9:124827133-124827155 GAATCCTATTGTACAAGGCCGGG + Intergenic
1061954572 9:133955158-133955180 GAGTCTGGCTGGAAATGGCCTGG - Intronic
1186978211 X:14931157-14931179 GAGTCTGATTTAAGAAGGGCTGG + Intergenic
1187528188 X:20072642-20072664 GAGTCTGAGTGGACTAGGTGGGG - Intronic
1189351277 X:40277631-40277653 GACTCTGATTGGATAAGGGGTGG - Intergenic
1190291667 X:48997155-48997177 GAGAGTGATTGGACAGGGTCTGG - Intronic
1192140296 X:68641518-68641540 GAGTCTGAGTGGACTAGGTGGGG + Intergenic
1192419407 X:71015560-71015582 GAGTCTGAGTGGACTAGGTGGGG - Intergenic
1194810472 X:98381822-98381844 CAGTCTGATTCCAAAAGGCCTGG + Intergenic
1197635621 X:128911789-128911811 GATTATGAGTGGACAATGCCTGG + Intergenic
1199992014 X:152992846-152992868 GAGTCTGAATTGGCATGGCCTGG - Intronic
1200167813 X:154049441-154049463 GAGTCTGACTGGCAGAGGCCAGG + Intronic