ID: 1048344908

View in Genome Browser
Species Human (GRCh38)
Location 8:133569187-133569209
Sequence GTTTAGAGTCTGATTGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048344908_1048344919 30 Left 1048344908 8:133569187-133569209 CCTTGTCCAATCAGACTCTAAAC 0: 1
1: 0
2: 2
3: 6
4: 108
Right 1048344919 8:133569240-133569262 AAGCAAACTTCAGGGTTTGTGGG No data
1048344908_1048344912 6 Left 1048344908 8:133569187-133569209 CCTTGTCCAATCAGACTCTAAAC 0: 1
1: 0
2: 2
3: 6
4: 108
Right 1048344912 8:133569216-133569238 TGCCGGCCCAGAAAAATGCAGGG No data
1048344908_1048344911 5 Left 1048344908 8:133569187-133569209 CCTTGTCCAATCAGACTCTAAAC 0: 1
1: 0
2: 2
3: 6
4: 108
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data
1048344908_1048344918 29 Left 1048344908 8:133569187-133569209 CCTTGTCCAATCAGACTCTAAAC 0: 1
1: 0
2: 2
3: 6
4: 108
Right 1048344918 8:133569239-133569261 AAAGCAAACTTCAGGGTTTGTGG No data
1048344908_1048344916 21 Left 1048344908 8:133569187-133569209 CCTTGTCCAATCAGACTCTAAAC 0: 1
1: 0
2: 2
3: 6
4: 108
Right 1048344916 8:133569231-133569253 ATGCAGGGAAAGCAAACTTCAGG No data
1048344908_1048344917 22 Left 1048344908 8:133569187-133569209 CCTTGTCCAATCAGACTCTAAAC 0: 1
1: 0
2: 2
3: 6
4: 108
Right 1048344917 8:133569232-133569254 TGCAGGGAAAGCAAACTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048344908 Original CRISPR GTTTAGAGTCTGATTGGACA AGG (reversed) Intronic
901151316 1:7104690-7104712 GTTGACAGTCTGATTGGAAGGGG - Intronic
901281158 1:8036240-8036262 GTTTTTAGACTGAGTGGACAGGG + Intergenic
906402185 1:45512880-45512902 GATTAGAGTCTGATTATATAGGG - Exonic
908127677 1:61047456-61047478 AGTTAGATTCTGACTGGACATGG + Intronic
912607805 1:111010104-111010126 GTTTAAAGTCTGTTTTGTCAGGG - Intergenic
912678907 1:111715474-111715496 GTTTACAATCTAATTGGGCAGGG + Exonic
913041074 1:115024376-115024398 GCTTACAGTCTGGTTGGAAAGGG + Intergenic
915944520 1:160140161-160140183 GTTTAGAATCTGATGGGAAGAGG - Intronic
921080319 1:211733704-211733726 GATTAGAGTATGATTGGAAGGGG - Intergenic
923611380 1:235498221-235498243 GTTTAGAGCCAGATTGGTAAAGG - Intronic
924728361 1:246690461-246690483 GCTTAGAGTCTGATGGGGCTGGG + Intergenic
1062837492 10:645358-645380 GTTTAGGGTCTGCATGGAGAAGG - Intronic
1064498078 10:15937026-15937048 GTTTTGCTTGTGATTGGACAGGG + Intergenic
1064601573 10:16998743-16998765 GTTTAGAGGATGGTTGGTCAAGG + Intronic
1064714646 10:18164137-18164159 GTTTACATTGTGATTGCACATGG - Intronic
1066075197 10:31868417-31868439 CTTTAGAGTTTGAGGGGACAAGG + Intronic
1069133114 10:64730763-64730785 ATTTAGTGTCTGAATTGACATGG + Intergenic
1075490357 10:122862245-122862267 GTTTAGAATCTAATTAAACAAGG - Intronic
1076400367 10:130179923-130179945 GTTTAGAGACTCATTTCACAAGG + Intronic
1079485914 11:20935831-20935853 ATTTGGACACTGATTGGACATGG + Intronic
1088167344 11:106954786-106954808 GTTTAAAGTCTGTTTTGTCAGGG + Intronic
1092739733 12:11616068-11616090 GTTTAGAGTCACATTGGACTAGG + Intergenic
1093375703 12:18424948-18424970 GTCTATAGTATGATTGGAAATGG + Intronic
1095459690 12:42430064-42430086 GTTTAGGGGCTGATTGCCCAGGG + Intronic
1099709922 12:86210934-86210956 GTTTCTAATCTGATTGGAGAGGG + Intronic
1100699135 12:97127860-97127882 GTTTAGAGGCAGAGTTGACATGG + Intergenic
1101571998 12:105962220-105962242 GTTTGGTGACTAATTGGACATGG + Intergenic
1108436317 13:50404870-50404892 GCTTAGAGTATGGTTGGAAATGG - Intronic
1109990670 13:70052106-70052128 GTTTGGATTCTGATTGGAACTGG - Intronic
1110819199 13:79894769-79894791 GTTTAGAGTAAGAATGGAGAAGG - Intergenic
1115560285 14:34576737-34576759 TTATAGAGTCTGACTGGGCATGG - Intronic
1119057029 14:71432996-71433018 GCTTAGAGTGTGAATGGAAAGGG + Intronic
1119173008 14:72548912-72548934 GTTTAGAAGCTGAATGGCCAAGG + Intronic
1126409813 15:48361638-48361660 GTTTAGACTCAGAGTGGAGAGGG - Intergenic
1128288206 15:66456213-66456235 GCTTAGAGTCTAATGGGAAAGGG + Intronic
1138504370 16:57470354-57470376 GGTAAGAGCCTGGTTGGACATGG + Exonic
1139912900 16:70409065-70409087 GTTTTGAGTCGGAGTGGGCAGGG + Intronic
1140346295 16:74216213-74216235 GTTAAGAGCCTGTCTGGACAAGG - Intergenic
1140770999 16:78203984-78204006 ATCTATAGTCTGCTTGGACATGG + Intronic
1141307377 16:82878513-82878535 GTTTAGAGTGTGTTTAGAGAGGG - Intronic
1146459024 17:33029271-33029293 GGTTGGGGACTGATTGGACAGGG - Intronic
1147346001 17:39795695-39795717 AATTAGAATCTGGTTGGACACGG - Intronic
1148843957 17:50517808-50517830 GTTTTGAGTCTGAGTTGATAAGG + Intronic
1149356025 17:55840158-55840180 GCATAGAGTCTGCTGGGACAGGG + Intronic
1155835672 18:30580969-30580991 ATTTAGATTCTGTTTGGAAAGGG + Intergenic
1155898655 18:31360973-31360995 CTTTGAAGTCTGATGGGACATGG - Intergenic
1159039513 18:63310310-63310332 GTGGAGAGTCTGATTTGACTGGG - Intronic
1161181252 19:2884205-2884227 CTTCAGACTCTGATTTGACAGGG - Intergenic
926513019 2:13806086-13806108 GTTTGGAGTAGGATTGTACATGG + Intergenic
928367811 2:30716178-30716200 GTTTAGAGTCTGGCTAGAGATGG + Intergenic
929748244 2:44681784-44681806 GTTTAGAGTTTGATAGAACAGGG + Intronic
930291726 2:49502576-49502598 GTTTACAGTCTGTGTGAACATGG + Intergenic
930920921 2:56752625-56752647 GTTTACAGTCTTAATAGACAAGG - Intergenic
931998759 2:67864127-67864149 GCTTAGAGTCAGATTGGCCTGGG - Intergenic
933845231 2:86320730-86320752 GTTTAGCAGCTGATTAGACATGG + Intronic
937007678 2:118532323-118532345 GTTTAGAATCTGATGGGACAAGG - Intergenic
939516342 2:143172974-143172996 GTTAAAAGACTGATTGGAAAAGG + Intronic
943075722 2:183191744-183191766 TTTTAGAATCTGATTGCATATGG - Intergenic
943294022 2:186114565-186114587 GTTTAGAGTCTAGTTGGGCAGGG + Intergenic
944014949 2:195024866-195024888 TTTTAGGTTCTGATTGGACATGG - Intergenic
944275886 2:197837086-197837108 ATTTAGAGTCTCCTTGGAAAGGG + Intronic
944498136 2:200329351-200329373 GTTTTGAGTGTGATGGGAAATGG + Intronic
944655991 2:201877254-201877276 GGCTGCAGTCTGATTGGACAGGG - Intronic
1168856850 20:1014662-1014684 GTTGACCGTCTGGTTGGACAGGG + Intergenic
1174331058 20:49818253-49818275 GTTTATAATCTGTTTGGAGAGGG - Intronic
1179403899 21:41109652-41109674 GTTTAGAATTTGATGGGAGAAGG + Intergenic
949436556 3:4035898-4035920 GTTTAGGGGGTGAGTGGACAGGG + Intronic
956324161 3:68032595-68032617 GTTTGGAGTCTGGATGAACATGG - Intronic
957430934 3:80105369-80105391 CTTTAGCCTCTGATTGGCCATGG + Intergenic
960832151 3:121861455-121861477 GTTTAAAGTCTGTTTTGTCAGGG + Intronic
961051959 3:123754425-123754447 GTTTAGATTTTGATAGGAAAGGG - Intronic
961070469 3:123919448-123919470 GTTTAGAATCTAATTGGGCAGGG - Intronic
963673996 3:148285798-148285820 TTTTAGTGTTTGATTGGACCTGG - Intergenic
965263564 3:166512829-166512851 GTTTAAAGTCTGTTTTGTCAGGG - Intergenic
969782156 4:9414628-9414650 GTTTAAACTCTGATTTGTCAGGG + Intergenic
970682191 4:18522778-18522800 GGTAAGAGTCTGATTACACAGGG - Intergenic
971059135 4:22947527-22947549 GTACAAAATCTGATTGGACATGG - Intergenic
971765087 4:30820422-30820444 GTGAAGAGTCTGATTGGACAAGG + Intronic
978197528 4:105988711-105988733 GTTAAGAGTCTGGGTGGGCATGG + Intronic
979735283 4:124074946-124074968 GTTTAAAGTCTGTTTTGTCAGGG - Intergenic
982193981 4:152890759-152890781 GTTTAGAGTTTGGATGAACAGGG + Intronic
983199776 4:164848613-164848635 GAATAAAGTCTGATTGGAGAAGG - Intergenic
989281129 5:39644758-39644780 GTTTAGCTTCTGATTGGATAGGG - Intergenic
991111032 5:62899724-62899746 ATTTGGAGACTGATTGTACAGGG + Intergenic
993072292 5:83180188-83180210 GTTAAGAGTGTGGTTGGAGAAGG + Intronic
993746044 5:91598323-91598345 CTTTAGCTTCTGATTGGGCATGG + Intergenic
995192827 5:109337525-109337547 AACTAGAGTCTGATTGGGCAGGG - Intronic
996503256 5:124240308-124240330 GATTAGATTCTGGTTGGCCAAGG - Intergenic
997624536 5:135322811-135322833 CTTTAGAGTCTGAGAGGACTGGG + Intronic
998775545 5:145596679-145596701 GTTTAGGTTCTGATTGCGCAGGG - Intronic
1000994479 5:167945074-167945096 ATTTAGAGTCTCAGAGGACAGGG - Intronic
1004572114 6:16856859-16856881 GTTTTGAGTTGCATTGGACAAGG + Intergenic
1012537561 6:100317459-100317481 GTTTAGATACTATTTGGACATGG + Intergenic
1019118048 6:169781591-169781613 GTTGAGGGTCTGCTTGGCCAGGG + Intergenic
1019799650 7:3078843-3078865 CTTTGGAGTCTGTTTGGAAAAGG + Intergenic
1021697023 7:23285836-23285858 CTTTAGCCTCTGATTGGTCACGG + Intergenic
1027731374 7:81877867-81877889 GTTTAGAGTCTCATAGAACTAGG + Intergenic
1032207680 7:129882457-129882479 GTTCTGTGTCTCATTGGACACGG - Intronic
1033639634 7:143249067-143249089 GTTTGGAATCTGGCTGGACAGGG - Intronic
1034786792 7:153933836-153933858 GTTTAGAGTCCCATAGGGCATGG + Intronic
1038911562 8:31970573-31970595 GTTGAGAGTTTGACTGCACAGGG - Intronic
1044877462 8:96684247-96684269 GTTTTGATTCTGGTTGGGCACGG + Intronic
1045400285 8:101809203-101809225 GTTTAAAGTCTTCCTGGACATGG + Intronic
1046744456 8:117862173-117862195 TTAAAGAGTCTGAATGGACAGGG + Intronic
1048344908 8:133569187-133569209 GTTTAGAGTCTGATTGGACAAGG - Intronic
1051998252 9:23246101-23246123 GCTTAGAGTCTGTATGAACATGG + Intergenic
1052755052 9:32532495-32532517 GCTTAGAGTCTGATTGAAGGAGG + Intergenic
1053091846 9:35285861-35285883 GTTTGTTGACTGATTGGACATGG + Intronic
1053343495 9:37360631-37360653 TTTGAGAGACTGGTTGGACATGG + Intergenic
1054968822 9:71061108-71061130 TTTCAGAGTCTTATTGTACACGG - Intronic
1188557058 X:31424367-31424389 GCATAGACTGTGATTGGACAAGG + Intronic
1191657674 X:63615823-63615845 GTTTAAAGTCTGTTTTAACAGGG - Intergenic
1192786289 X:74339263-74339285 GTTTAGAGGCAGATTGGAGCAGG - Intergenic
1195166813 X:102228117-102228139 GTTTGGATTCAGAATGGACAGGG + Intergenic
1195192047 X:102458971-102458993 GTTTGGATTCAGAATGGACAGGG - Intronic
1199653456 X:149971182-149971204 GTTTAGTGTATGAATGAACATGG + Intergenic
1200768551 Y:7102493-7102515 GTGGAGAGTCTCAGTGGACAGGG + Intergenic