ID: 1048344909

View in Genome Browser
Species Human (GRCh38)
Location 8:133569193-133569215
Sequence TTTGCTGTTTAGAGTCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048344909_1048344912 0 Left 1048344909 8:133569193-133569215 CCAATCAGACTCTAAACAGCAAA 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1048344912 8:133569216-133569238 TGCCGGCCCAGAAAAATGCAGGG No data
1048344909_1048344919 24 Left 1048344909 8:133569193-133569215 CCAATCAGACTCTAAACAGCAAA 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1048344919 8:133569240-133569262 AAGCAAACTTCAGGGTTTGTGGG No data
1048344909_1048344916 15 Left 1048344909 8:133569193-133569215 CCAATCAGACTCTAAACAGCAAA 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1048344916 8:133569231-133569253 ATGCAGGGAAAGCAAACTTCAGG No data
1048344909_1048344918 23 Left 1048344909 8:133569193-133569215 CCAATCAGACTCTAAACAGCAAA 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1048344918 8:133569239-133569261 AAAGCAAACTTCAGGGTTTGTGG No data
1048344909_1048344917 16 Left 1048344909 8:133569193-133569215 CCAATCAGACTCTAAACAGCAAA 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1048344917 8:133569232-133569254 TGCAGGGAAAGCAAACTTCAGGG No data
1048344909_1048344911 -1 Left 1048344909 8:133569193-133569215 CCAATCAGACTCTAAACAGCAAA 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048344909 Original CRISPR TTTGCTGTTTAGAGTCTGAT TGG (reversed) Intronic
901117171 1:6856454-6856476 TTTGCAGTTTATAGGCTGATAGG + Intronic
907658553 1:56370386-56370408 TTTGCTATTTAGTGTCTGTGTGG - Intergenic
909572525 1:77132800-77132822 TTTGCTGTGTAGAGAATGATAGG + Intronic
909731747 1:78900315-78900337 TTTTCTGCTTAGAGTCTCACTGG - Intronic
910036195 1:82791956-82791978 TTTGCTGTTCTGGGTGTGATCGG + Intergenic
910383455 1:86656897-86656919 TCTGATGTTGAGAGTCTGAGGGG - Intergenic
910503192 1:87918381-87918403 TTTGGTTTTTAGAGTGTGTTTGG + Intergenic
911971961 1:104450720-104450742 TTTGCTGTGCAGAATCTGTTAGG + Intergenic
912592515 1:110838952-110838974 TTTGATGATTAAAGTCTGAAAGG + Intergenic
916065217 1:161131402-161131424 TTTGCTGTTTTAAGTCTGGAAGG - Intronic
916890759 1:169110155-169110177 TTAACTGTTTAGTGCCTGATAGG + Intronic
917278755 1:173358865-173358887 TATGCTGTTTAAAGTCAGATAGG + Intergenic
919237671 1:194867160-194867182 TTTGCTGTTCAGAGCATGGTTGG + Intergenic
920402951 1:205688239-205688261 TTTGCTATTTAGAGATTTATTGG - Intergenic
923808058 1:237282198-237282220 TTTTCTGTATAGAGCCAGATGGG + Intronic
923864086 1:237920116-237920138 CCTGTTGTTTCGAGTCTGATGGG + Intergenic
1064498076 10:15937020-15937042 TTTGCTGTTTTGCTTGTGATTGG + Intergenic
1068151610 10:53139512-53139534 TTTGCTGTTTATAGCCTTCTTGG + Intergenic
1069754244 10:70763610-70763632 TTTCCTGTTTGGAGTCTGGTGGG + Intergenic
1076449163 10:130544365-130544387 TTTGCTGGTTTGTGTGTGATGGG + Intergenic
1078055640 11:8006867-8006889 TTTGCAGATTATAATCTGATTGG - Intergenic
1079477896 11:20850362-20850384 TCTGCTGATTAGAGTATGAAAGG + Intronic
1081111501 11:39139459-39139481 TTTGCTATTTAGAGTCAGTTAGG - Intergenic
1085182150 11:74544891-74544913 TTTTCTGTTGTGAGCCTGATCGG + Intronic
1085708486 11:78808250-78808272 TTTGCTATTTAGGGTCTTAAAGG + Intronic
1087370293 11:97275253-97275275 TCTGCTGTTAATAGTTTGATAGG - Intergenic
1089402146 11:118170536-118170558 TTTCCTCTTTGGAGTGTGATAGG + Intronic
1089844110 11:121445125-121445147 CTTGCAGTTTTGAGTCTGGTGGG + Intergenic
1090620101 11:128553034-128553056 GTTGCTGTTTATAGTCTGACTGG - Intronic
1093814202 12:23524217-23524239 TTAGCTGTGTTGAGGCTGATTGG + Intergenic
1094312727 12:29103169-29103191 TTTGCTGTTTTCATTTTGATAGG + Intergenic
1095723884 12:45430940-45430962 TTTGCTGCTGGGATTCTGATAGG - Exonic
1095974700 12:47931307-47931329 TTTGCTTTGAAGAGTCTCATTGG - Intronic
1101137718 12:101762775-101762797 ATTGCTGTTAATAGTTTGATGGG - Intronic
1101292396 12:103384656-103384678 TCTGCTCTTTAGTCTCTGATTGG - Intronic
1102831407 12:116004576-116004598 TTGGATGATTAGAGACTGATAGG - Intronic
1104180354 12:126373811-126373833 TTTGCTGTCCAAAGTCTGATAGG - Intergenic
1106173244 13:27307282-27307304 TTTGCTGGTTCCAGTCTGCTGGG + Intergenic
1106411845 13:29516137-29516159 TTTGCTGTGTGGATGCTGATAGG - Exonic
1106987918 13:35377412-35377434 TTTGGAGATTAGGGTCTGATGGG + Intronic
1107118806 13:36776303-36776325 TTTGAAATTTAGAGGCTGATGGG + Intergenic
1107837386 13:44422908-44422930 TTTCCTGTTTCGAGTCTGCCTGG + Intergenic
1108103675 13:46985473-46985495 TTTGCAGTTAAGAAACTGATGGG - Intergenic
1109561564 13:64056308-64056330 ATTGTTGAATAGAGTCTGATGGG - Intergenic
1110118258 13:71846892-71846914 TTTAGTGTTTAGTGTTTGATAGG - Intronic
1110354921 13:74556242-74556264 TTTGCTGTTTAGGGAATCATCGG - Intergenic
1110865757 13:80393887-80393909 TTTGCTGCTTATAGTCAAATGGG + Intergenic
1111501207 13:89122446-89122468 TTTGTTGTTTAAAGTGTGTTAGG - Intergenic
1111912767 13:94330268-94330290 TTTACCGTTTAAAGTCTGTTTGG + Intronic
1118120806 14:62840040-62840062 TATGTTGTTCAGAGTCTGATGGG - Intronic
1122040574 14:98984951-98984973 ATTGCTGTTTTGAGCCTGTTGGG - Intergenic
1126082630 15:44980223-44980245 CATGCTATATAGAGTCTGATTGG + Intergenic
1127119031 15:55755309-55755331 GTTGCTGTTTACTGTCTGCTGGG + Intergenic
1132076651 15:98827083-98827105 ATTTCTGTTTAGAGGCTGGTTGG + Intronic
1132861520 16:2074025-2074047 TCTGCTGTGCAGAGTCTGCTCGG + Intronic
1133805432 16:9122972-9122994 TTTGCTGTTTGGGGTCTCTTAGG + Intergenic
1141919556 16:87126915-87126937 TTTGCTGGTTAAAGACTGACAGG - Intronic
1143246634 17:5491900-5491922 TTTACTTTTTAGAGGATGATAGG - Intergenic
1151371671 17:73650661-73650683 TTGGCTGTGTAGACTCTGAGAGG - Intergenic
1153392041 18:4573577-4573599 TTTGCTGGTTAGAATCTCTTTGG - Intergenic
1155593393 18:27453860-27453882 TTTATTTTTTAGAGTCTGTTAGG + Intergenic
1156086649 18:33414061-33414083 TTTGCTATTTAGAGTGTCTTTGG - Intronic
1160834959 19:1120247-1120269 TGTGTTGTTTAGAGTCTGGGAGG - Intronic
1164549804 19:29200205-29200227 AATGCTGTATAGAGTCTAATTGG + Intergenic
1164697859 19:30260373-30260395 TTGTCTGTTTAGAGTTTGCTGGG + Intronic
927044846 2:19266768-19266790 TTTGCTGTTCAGATTCTCAAAGG + Intergenic
927265171 2:21138800-21138822 TTTGCAGTTGAGAGTTTTATGGG + Exonic
928630425 2:33185933-33185955 TGTGATGTTTAAAGGCTGATAGG + Intronic
929044868 2:37779651-37779673 ATAGCTGTCTATAGTCTGATTGG - Intergenic
929306764 2:40372163-40372185 TTTTCTGTTTAGATTCTTAGAGG - Intronic
929501701 2:42495439-42495461 TTTGCTATTTAGTGTCTACTGGG + Intronic
929721095 2:44368706-44368728 TTTACTGTTTGGAGTTTAATTGG + Intronic
929798099 2:45075621-45075643 TTTGTTGTCTAGACTCTGTTAGG - Intergenic
932525966 2:72468613-72468635 TTTGCTATTTGGAGTCTTAGTGG + Intronic
932845879 2:75135556-75135578 TTTGCTGTTTTGAGTATCTTTGG - Intronic
936793383 2:116178085-116178107 TTTGCTTTTTATAGAATGATAGG - Intergenic
940335400 2:152521574-152521596 TTTTCTGTTTTGTGTCTGGTGGG + Intronic
940602460 2:155879084-155879106 TTTGCTGTGTATAGTCTCCTTGG - Intergenic
942494306 2:176523130-176523152 TTTTCTGTCTAGAGTTTGAAGGG - Intergenic
942891424 2:180993667-180993689 TTTGCCATTTACAGTCTTATAGG + Intronic
944499251 2:200341501-200341523 TTTTCTGTTATGAGTCTTATTGG + Intronic
945498030 2:210533737-210533759 TTTGCAGTTTAGAGGCTTCTTGG + Intronic
1169827724 20:9788426-9788448 TTAGCTGTTTAGAATCTGGGTGG - Intronic
1169943142 20:10959524-10959546 TTTGCTGAGTAGTGTCTGCTGGG + Intergenic
1170137597 20:13091967-13091989 TATGTAGTTTAGAGTCTAATGGG + Intronic
1170154635 20:13258222-13258244 CTTGCTGTCTAGCTTCTGATTGG + Intronic
1170652863 20:18258609-18258631 CTTGCTGTTTGGAGTGGGATTGG - Intergenic
1172015658 20:31870917-31870939 TCTGCTCTTCAGAGTCTGCTTGG + Intronic
1174867469 20:54151332-54151354 TTTTCTGTTTAGAGTCTTCTTGG + Intergenic
1175946196 20:62559879-62559901 TTTGGTGCACAGAGTCTGATTGG - Intronic
1176989545 21:15478705-15478727 TTTGGTATCTAGAGACTGATGGG + Intergenic
1177870450 21:26566542-26566564 TTTACAGCTTAGAGTCTAATGGG - Intronic
1182466061 22:30517022-30517044 TTTGCTGTTTAAAGTGAGGTAGG - Intergenic
949723470 3:7017274-7017296 TTTCCTTTTTAAAGTCTGACTGG - Intronic
951368034 3:21808789-21808811 TTTGCTGTGTGGATTCTGGTTGG - Intronic
951703137 3:25516257-25516279 TTAGCTGTTTATTATCTGATGGG - Intronic
951825430 3:26863365-26863387 TTCTCTGTTTAAAATCTGATTGG - Intergenic
958097649 3:88967572-88967594 TTTGCTCTTTAGAGTCTGAATGG - Intergenic
958485971 3:94709430-94709452 TTTGAGGTTTACAGTTTGATGGG - Intergenic
959780472 3:110226994-110227016 ATTGCTGTTGACAGTATGATTGG - Intergenic
960463112 3:117961192-117961214 TGTGCATTTTAGATTCTGATAGG + Intergenic
961070472 3:123919454-123919476 ACTGCTGTTTAGAATCTAATTGG - Intronic
963657733 3:148079476-148079498 TTTGCTGTTGAGAGGATGCTTGG - Intergenic
965112877 3:164449698-164449720 TTTTTTGTTTAAAGTCTGTTTGG + Intergenic
970889483 4:21026713-21026735 ATTTCTTTTTAGAATCTGATTGG + Intronic
971223604 4:24731736-24731758 TTTTCTGTAAAGAGTCAGATAGG - Intergenic
972996705 4:44888236-44888258 TTTGCTGTTCAGAATCTATTTGG + Intergenic
973753842 4:54052578-54052600 TTTGGTTATTAGAGTCTGAAGGG - Intronic
974067862 4:57096945-57096967 TTTGGCTTTTAGAGTCTTATTGG - Intronic
975401173 4:73941542-73941564 TTTGCTTTCAATAGTCTGATGGG - Intergenic
975831369 4:78372706-78372728 CTTTCTTTTTAGAGTGTGATTGG + Exonic
976320246 4:83706102-83706124 TTTACTGATTAGACTCTGAATGG - Intergenic
976780984 4:88758847-88758869 TCTGCTGTTTGGTGTCAGATAGG + Exonic
979639371 4:122995681-122995703 TTTTCCATTTAGAGTCTGAGAGG - Intronic
983808934 4:172032901-172032923 TTTTCTCTTTATAATCTGATTGG + Intronic
984292312 4:177810788-177810810 TTGGCTGTTCAGAGTCTGAAGGG + Intronic
986418687 5:7554338-7554360 TTTACTGTTTAGAATGTCATTGG - Intronic
988114605 5:26868444-26868466 TTTTCTGATTAGAGTCTAACAGG - Intergenic
989147088 5:38259247-38259269 TTTCCTGTTAAGTGTCTGAAGGG + Intronic
989471498 5:41824406-41824428 TTAGCTGTATAGAGTCTACTTGG + Intronic
992678635 5:79130788-79130810 TTTGCTTTTTAATGTCTGATAGG + Intronic
993801206 5:92340201-92340223 TCTGCTATTCAGAGTCTGCTGGG + Intergenic
995543178 5:113203926-113203948 TTTGCTCTTAAGAATCTGAATGG - Intronic
995621986 5:114036060-114036082 TTGGCTGTTCAGAGTCTTTTTGG + Intergenic
1000312686 5:160060674-160060696 CCTGCTGTTTAGAGTCAGGTTGG - Intronic
1000394897 5:160763683-160763705 TTTGCTATTTCTATTCTGATGGG - Intronic
1000529736 5:162404829-162404851 CTTGGGGTTTAGAGTCTGACTGG - Intergenic
1001168259 5:169391540-169391562 TTGGATGACTAGAGTCTGATGGG - Intergenic
1001914572 5:175548995-175549017 TTGGCTTGTCAGAGTCTGATTGG + Intergenic
1008127117 6:47681281-47681303 TTTGCTGTTAAGAATGTGGTTGG - Exonic
1008532012 6:52470720-52470742 TTTGCAGTTTACAGACTCATAGG - Intronic
1010347476 6:74828988-74829010 TTTGATGTTTACAATCTGATTGG + Intergenic
1011639983 6:89409704-89409726 TTTGCTCTCTAGTGTCAGATAGG - Intronic
1016516971 6:144904977-144904999 TTTGCCATTTAGAGACTGCTAGG - Intergenic
1018605183 6:165589852-165589874 TTTGTTTTTTAGTGGCTGATTGG - Intronic
1019397090 7:826889-826911 GTTGCTGTTTATAGGCTGAAGGG + Intronic
1020565909 7:9795056-9795078 TTTGGAGTTCAGAGTCTGATAGG - Intergenic
1023113021 7:36833314-36833336 TTAGCTGTTCACCGTCTGATTGG - Intergenic
1024799291 7:53057687-53057709 TCTGCTTTTTAGGGTCTGATGGG - Intergenic
1025922256 7:65924308-65924330 TTTGCTGCTAAGTGGCTGATTGG - Intronic
1026379465 7:69784464-69784486 TTTGTTCTTTGGAGTCTGAGGGG + Intronic
1028803122 7:94991561-94991583 TATGCTTTTGGGAGTCTGATTGG + Intronic
1028965266 7:96795166-96795188 GTTGCTGTGTAGAATCTGGTTGG - Intergenic
1029276785 7:99409917-99409939 TTTGCTATTTAGATTGGGATCGG + Intronic
1029277037 7:99412182-99412204 TTTGCAGTTTAGATTTGGATGGG + Intronic
1029906159 7:104095313-104095335 TTTGCTGATTAGTGTCTTAAAGG + Intergenic
1030742697 7:113128595-113128617 TTTGCTGTGTTAAGTCTGCTTGG - Intergenic
1034390766 7:150785861-150785883 TTTCCTGTTTATACTCTGAATGG + Intergenic
1035014763 7:155755578-155755600 AATGCTGCTTAGCGTCTGATAGG + Intronic
1035822970 8:2614796-2614818 TTTGCTTTCTAGAGTCTGAAAGG + Intergenic
1037597053 8:20363053-20363075 TGTGCTCTTTAGAAACTGATTGG + Intergenic
1038222118 8:25620389-25620411 TATGCTGTTGAGATTTTGATAGG - Intergenic
1039215861 8:35269989-35270011 TTTACTGTTTGGAGTAGGATGGG + Intronic
1041127572 8:54659757-54659779 ATTGCTGTTGAGATTTTGATAGG + Intergenic
1041379047 8:57233324-57233346 TTTGCAGTTTACAGTGTGGTTGG - Intergenic
1041901491 8:62987896-62987918 TTTGATTTTTACAGTCTCATAGG - Intronic
1043766522 8:84140753-84140775 TTTGCTGTTTATATTCTTATAGG + Intergenic
1044637894 8:94345304-94345326 TTTGCAGTTTCCAGTCTGATGGG - Intergenic
1046545023 8:115638932-115638954 TTAGCAGTTTATAGTCTAATGGG - Intronic
1048344909 8:133569193-133569215 TTTGCTGTTTAGAGTCTGATTGG - Intronic
1048491472 8:134897568-134897590 TTTGCCATTTAGAGGCTGGTTGG + Intergenic
1051024713 9:12594498-12594520 ATTGTTGCTTAGAGTCTAATGGG + Intergenic
1053292882 9:36893588-36893610 TTTGCTGTTTTTAATCTGCTGGG - Intronic
1056265676 9:84894475-84894497 TTTGCTGAGTAGTATCTGATGGG - Intronic
1057416381 9:94867128-94867150 TTTGCTGTTTCAAATCTGAATGG - Intronic
1057845446 9:98519035-98519057 TTTACTCTGTAGAGTCTGAATGG + Intronic
1059221594 9:112625778-112625800 TTTTCTTTTTGGAGTTTGATAGG + Intronic
1061403419 9:130380960-130380982 GCTGATGGTTAGAGTCTGATCGG - Intronic
1186726435 X:12364014-12364036 TTTGCTGTTTAGAATCTATGAGG + Intronic
1187565544 X:20446078-20446100 TTTGTTTTTTAGAGTCTAGTTGG - Intergenic
1187651853 X:21418550-21418572 TTTGCTGTTTATACTCTTCTAGG + Intronic
1188426537 X:30053686-30053708 TTTGTTCTTGAGAGTCTGACAGG - Intergenic
1190430646 X:50375043-50375065 ATTTCTGCTTAGAGTCTGAGAGG + Exonic
1191034603 X:56010824-56010846 GTTGTTGTTTAAAGTCTGTTTGG - Intergenic
1192021751 X:67400799-67400821 GTTGCTGTTTAAAGTCTGTTTGG + Intergenic
1194232799 X:91345195-91345217 TTTGCTCTTTTGAGTCTGATGGG + Intergenic
1194830459 X:98617603-98617625 TCTGCTGTTGTTAGTCTGATGGG + Intergenic
1195777390 X:108422611-108422633 ATTGCGTTTTAGAGTCAGATTGG - Intronic
1196361380 X:114864823-114864845 ATTGCTGTATAGAGTATGCTTGG + Intronic
1196526401 X:116732320-116732342 TTTACTGTTTTGAGGCTGAGTGG + Intergenic
1199398767 X:147372106-147372128 ATTGATGTTCAGAGTTTGATAGG + Intergenic