ID: 1048344911

View in Genome Browser
Species Human (GRCh38)
Location 8:133569215-133569237
Sequence ATGCCGGCCCAGAAAAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048344908_1048344911 5 Left 1048344908 8:133569187-133569209 CCTTGTCCAATCAGACTCTAAAC 0: 1
1: 0
2: 2
3: 6
4: 108
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data
1048344907_1048344911 10 Left 1048344907 8:133569182-133569204 CCTGGCCTTGTCCAATCAGACTC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data
1048344902_1048344911 28 Left 1048344902 8:133569164-133569186 CCCTGCTCAAGCCCAGGTCCTGG 0: 1
1: 0
2: 1
3: 31
4: 677
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data
1048344905_1048344911 17 Left 1048344905 8:133569175-133569197 CCCAGGTCCTGGCCTTGTCCAAT 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data
1048344909_1048344911 -1 Left 1048344909 8:133569193-133569215 CCAATCAGACTCTAAACAGCAAA 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data
1048344904_1048344911 27 Left 1048344904 8:133569165-133569187 CCTGCTCAAGCCCAGGTCCTGGC 0: 1
1: 0
2: 4
3: 34
4: 347
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data
1048344906_1048344911 16 Left 1048344906 8:133569176-133569198 CCAGGTCCTGGCCTTGTCCAATC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048344911 Original CRISPR ATGCCGGCCCAGAAAAATGC AGG Intronic
No off target data available for this crispr