ID: 1048345044

View in Genome Browser
Species Human (GRCh38)
Location 8:133570008-133570030
Sequence GGCCCCAAGGTGGAAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048345044_1048345051 25 Left 1048345044 8:133570008-133570030 CCAGCACCTTCCACCTTGGGGCC 0: 1
1: 0
2: 3
3: 33
4: 311
Right 1048345051 8:133570056-133570078 CTACGACGTGCCAGGCGCCCTGG No data
1048345044_1048345049 17 Left 1048345044 8:133570008-133570030 CCAGCACCTTCCACCTTGGGGCC 0: 1
1: 0
2: 3
3: 33
4: 311
Right 1048345049 8:133570048-133570070 GTTAGCACCTACGACGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048345044 Original CRISPR GGCCCCAAGGTGGAAGGTGC TGG (reversed) Intronic
900214072 1:1471912-1471934 GGCCCCAAGGGTGAAGGCGCGGG + Exonic
900221621 1:1512296-1512318 GGCCCCAAGGGTGAAGGCGCGGG + Exonic
900314625 1:2050646-2050668 GGCCCCAAGATGGAAGGGAGCGG + Exonic
900405032 1:2489180-2489202 GGCCCCAAGGCAGAAAGAGCAGG - Intronic
900437833 1:2639926-2639948 GGCCCCCAGGCGGCAGGTGCAGG - Intronic
900566666 1:3335726-3335748 GGCATCCTGGTGGAAGGTGCTGG + Intronic
901023660 1:6267820-6267842 GGCTCCAGGGTTGAAGATGCTGG - Intronic
901626885 1:10629733-10629755 GGCCCCCAGGAGGAAGGCGAGGG + Exonic
901758467 1:11455615-11455637 CGCCCCAAGGAGCAAGGTGAAGG + Intergenic
902183837 1:14710542-14710564 GGACCCAGGGTGGAGTGTGCAGG - Intronic
902203687 1:14852171-14852193 AGCCCCAAGGTGGAGGGAGATGG - Intronic
902756967 1:18555444-18555466 GGCCCCCAGTGGAAAGGTGCTGG - Intergenic
902912244 1:19608356-19608378 GGCCCAGAGGTGCAAGGAGCTGG + Intronic
903380401 1:22892798-22892820 GCCCCCAATGTGGCAGGAGCAGG + Intronic
903574358 1:24329199-24329221 GGCCCCAAGGTGTGAGGAGCTGG - Intronic
904608916 1:31714701-31714723 GCCCCCGAGGTGGGAGGTGGTGG + Intergenic
904829828 1:33299546-33299568 GACCCCCAGGTGGGAGGGGCAGG + Exonic
904910829 1:33932920-33932942 AGCACCAAGGTGGAAGAGGCTGG + Intronic
905010174 1:34741897-34741919 AGCCCCAAGTTGGAAAGTGTAGG + Intronic
905277132 1:36825554-36825576 GGGCCCAAGGTTGAAGGTCTAGG - Intronic
905477447 1:38239000-38239022 CACGCCAAGGTGGAAGGAGCTGG + Intergenic
906670019 1:47647629-47647651 GGGCTCAAGGTGTAATGTGCAGG - Intergenic
907306303 1:53514924-53514946 GGCCCCAGTGAGGGAGGTGCTGG + Intronic
911053704 1:93693613-93693635 TCCCCCAAAGTGCAAGGTGCTGG + Intronic
911255403 1:95627639-95627661 GGCTTCGAGGTGGAAGCTGCAGG + Intergenic
911498197 1:98656099-98656121 GTCCCCAGGGTGGAATGTGTAGG - Intergenic
913342437 1:117772175-117772197 GGTCCCTTGGTGGAAGGGGCTGG + Intergenic
915165290 1:153945074-153945096 GGCTCCATGGTGGAGGGTGTGGG - Intronic
915380232 1:155433521-155433543 GGCACCAGGGGGGACGGTGCAGG - Intronic
915543160 1:156581603-156581625 AGCCCCCAGGTTGAAGGCGCAGG - Exonic
916167460 1:161976850-161976872 CGCCCCAGGGTGGAAGGGGTGGG - Intergenic
917858245 1:179119937-179119959 GTCACCATGGTGGAAGCTGCAGG - Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918226101 1:182484662-182484684 GGCCCCTAGGGGCAGGGTGCAGG + Intronic
919821124 1:201472661-201472683 GGCCCCAGGGAAGAATGTGCTGG + Intergenic
920281324 1:204845929-204845951 GGCTCCACGGGGGAAGGGGCTGG + Intronic
922898364 1:229117900-229117922 GGCTCCAAGGTGGAATGGACAGG + Intergenic
923148492 1:231214173-231214195 GGCCCTAAGGTGGCAGCTTCTGG + Intronic
924068753 1:240254489-240254511 GGCCCCTAGGTGGTACGTGTGGG + Intronic
924592462 1:245416713-245416735 GGCCCCACGGCAGAAGGAGCAGG + Intronic
1063418076 10:5889774-5889796 AGCCCCAAAGTGGAGGGTCCGGG + Exonic
1065407817 10:25388962-25388984 GGGGCCAAGGTGGCAGGGGCTGG - Intronic
1069059594 10:63881938-63881960 GGTCCCATGGTGGATGGTGCTGG + Intergenic
1070787544 10:79170762-79170784 AGGCCCAAAGTGGAACGTGCTGG + Intronic
1071666601 10:87564407-87564429 GGCCCCCAGGTAGCATGTGCAGG - Intergenic
1071666644 10:87564660-87564682 GGTCCCAAGGTGGCATATGCTGG - Intergenic
1072680274 10:97500701-97500723 GCCCCCAAGCTAGAAGGTGATGG - Intronic
1074848654 10:117421067-117421089 GGACACAAGGTGGAAGATCCAGG - Intergenic
1075091093 10:119444537-119444559 GGCCCCAAGGGGGCATGGGCTGG - Intronic
1076327959 10:129643147-129643169 GGGCCCAAGGATGAAGGTGAAGG - Intronic
1076459129 10:130627159-130627181 GACCCCAATGTGGGAGATGCAGG + Intergenic
1076803627 10:132844342-132844364 GGCCCCAGGATGGACGGTGAGGG + Intronic
1076882844 10:133247988-133248010 TGCCCCAATCTGGCAGGTGCGGG - Intergenic
1077035868 11:494226-494248 GGCTCCGGGGTGGAAGCTGCGGG + Intergenic
1077180083 11:1208401-1208423 GGCCCAAAGGTGAAAGGGGCGGG + Intergenic
1077319493 11:1934927-1934949 GGCCCCAGGGCCGGAGGTGCCGG - Intronic
1077848048 11:6046580-6046602 GGCCTCCAGGTGGATGGTGATGG + Intergenic
1079966776 11:26989766-26989788 GGTCTCAAGGTGGAAGGAGAGGG - Intergenic
1079967323 11:26994788-26994810 GGCCGCCAGGTGGAGGATGCTGG + Exonic
1080563398 11:33485078-33485100 TGTCCTAAGGTTGAAGGTGCTGG - Intergenic
1081477079 11:43444179-43444201 GGCCCCAAGGTGGCATCTCCTGG + Exonic
1081612086 11:44568777-44568799 GTCCCCAGGGTGGAAGGGGATGG - Intronic
1081718240 11:45266994-45267016 GGCCACAAGGTGGAAGAGGCTGG - Intronic
1082880025 11:58028134-58028156 GGCCCCAGGGTGGATGCTGGGGG + Intronic
1082998342 11:59270139-59270161 GACCCCAAGTTGGAAGGAGAGGG + Intergenic
1083415913 11:62525616-62525638 GGCCCCAAAGTGGACGTTGAAGG - Exonic
1083731110 11:64653261-64653283 GGCCACAAGGGGGAAGGCGAGGG - Intronic
1083776933 11:64898603-64898625 TGCCCCAGGGTGGATGGTGCAGG + Intronic
1083808238 11:65087778-65087800 CGCCCTATGGTGGCAGGTGCAGG + Intronic
1084072316 11:66744579-66744601 GGCCCGCAGGTGGGAGGTTCGGG - Intronic
1085722109 11:78921635-78921657 GGCCTAGAGATGGAAGGTGCAGG + Intronic
1090157948 11:124461279-124461301 AGCTGCAAGGTGGAAGCTGCAGG - Intergenic
1090167902 11:124570835-124570857 GGCTGCAAGGTGGGAGCTGCAGG - Exonic
1092778691 12:11965690-11965712 GTCACCAAGGTGGGCGGTGCTGG - Intergenic
1093007197 12:14063530-14063552 GGAACCACGGTGGATGGTGCAGG - Intergenic
1096073882 12:48789855-48789877 GGCTGCAAGTTGGCAGGTGCGGG - Intergenic
1096398806 12:51288222-51288244 GGCCCCCAGGTGGAAGGTGTGGG - Intronic
1097386126 12:58951789-58951811 TTCTCCAAGATGGAAGGTGCAGG + Intergenic
1099859496 12:88209201-88209223 TGCCCCAAGGTGGCATATGCTGG - Intergenic
1100433922 12:94554438-94554460 GGACCCATGGTGGGAGGGGCTGG + Intergenic
1101676701 12:106923726-106923748 GGCCTCAAGGCAGAAGGTGAAGG + Intergenic
1103305542 12:119961129-119961151 GGCCACCAGGTGGTAGGTCCAGG - Intergenic
1104008241 12:124910762-124910784 GAACCAAAGGTGGAAGTTGCAGG - Intergenic
1104998558 12:132674297-132674319 GGCCACAGGGTGGAGGCTGCGGG - Intronic
1105818889 13:24062432-24062454 GGCGCCAGGGTGCACGGTGCTGG + Intronic
1107286669 13:38801751-38801773 GGCCCCAAGGTAGTATATGCTGG + Intronic
1107981301 13:45736726-45736748 GGCCCCAAGGCTGGAGGTTCAGG + Intergenic
1108076975 13:46691589-46691611 GGCCTCAGGGTTGAAGGTGAAGG + Intronic
1108533497 13:51348348-51348370 GGTCCAGAGGTGGATGGTGCTGG - Exonic
1109829563 13:67769646-67769668 GTGCCCAAGGTGGAAGCCGCTGG - Intergenic
1110407301 13:75165199-75165221 GGCCTGAAGGTGGAATGTGGTGG + Intergenic
1113530473 13:111020738-111020760 GTCCCCCAGGTGGGAGCTGCCGG + Intergenic
1113589907 13:111491194-111491216 AGCCCCAAGCTGGATGGAGCAGG - Intergenic
1113613104 13:111661871-111661893 GGCCCCAATGTTGTAGGAGCCGG - Intronic
1113887165 13:113667055-113667077 GGCCCCTTGGAGGAAGGGGCCGG + Intergenic
1115631315 14:35248685-35248707 GCCACCAAGGTGGAGAGTGCAGG - Intronic
1118496525 14:66313173-66313195 GGTCCCAAGGTGGAACACGCTGG + Intergenic
1118710870 14:68518476-68518498 GGCCCCATGTTTGAAGGTTCTGG - Intronic
1118891281 14:69911291-69911313 GGGCCCAAGGTAGAAGGCCCAGG + Intronic
1119406641 14:74403189-74403211 GGCCCTAAGCTGGAAGGGGGTGG + Intergenic
1120408590 14:84121046-84121068 GCCCACAAGGTGGAGGGGGCTGG + Intergenic
1121463418 14:94099215-94099237 GGCACACAGGTGGCAGGTGCAGG + Intronic
1122203886 14:100138756-100138778 GGCCACATGGTGGAAGGGACAGG + Intronic
1122227572 14:100288598-100288620 GGTCCCGAGGTGGAAGGGGTGGG - Intergenic
1122249328 14:100427076-100427098 GGCCCCAAGGTGGCAGGGACAGG - Intronic
1122343495 14:101044047-101044069 GGCCACAATGTGCAAGGTGCAGG + Intergenic
1122545119 14:102517560-102517582 GGCCACCAGGTGGAGGGTACAGG - Intergenic
1123122982 14:105926711-105926733 GGCCCCATGGTGGCAGGGGTGGG - Intronic
1202940824 14_KI270725v1_random:143688-143710 GGCTCCTGGGTGGAAGGTGATGG + Intergenic
1124022442 15:25937141-25937163 ACCCCCAACATGGAAGGTGCAGG + Intergenic
1124175405 15:27419197-27419219 GGGCCAGAGCTGGAAGGTGCAGG - Intronic
1124508020 15:30295658-30295680 GGCCCAGAGGTGGAAGAGGCAGG + Intergenic
1124684923 15:31774324-31774346 GGCCCCTAGGTGCAAGGCACAGG - Intronic
1124735535 15:32242999-32243021 GGCCCAGAGGTGGAAGAGGCAGG - Intergenic
1126356548 15:47802135-47802157 TTCCCTCAGGTGGAAGGTGCTGG + Intergenic
1127333550 15:57962097-57962119 GGCGCCAAGCTGGAATGTGGAGG - Exonic
1128077394 15:64836212-64836234 GGTCCTAAGGTGGAAGGGACGGG - Intergenic
1128330753 15:66753913-66753935 GGCCCCAAGGGGCAGTGTGCAGG + Intronic
1128738412 15:70066637-70066659 AGCCTCAGGGTGGAAGATGCTGG - Intronic
1129070543 15:72946659-72946681 GGCCCCTAGGTGGCATGTGTGGG - Intergenic
1130738340 15:86572466-86572488 GGCCCCATCGTGGCAGTTGCCGG + Intronic
1130980172 15:88807097-88807119 TGGCCCTAGGTGGCAGGTGCTGG + Intronic
1131466208 15:92656482-92656504 GGCCCAAAGGTGGAAACTGATGG + Intronic
1132547777 16:541145-541167 GGCCCCCAGGTGGGAGGGACGGG + Intronic
1132822187 16:1879795-1879817 AGCCCCAAGAAGGAAGGTGGTGG - Intronic
1132881275 16:2162737-2162759 GGCCTCGAGGTGGACAGTGCAGG + Intronic
1133722528 16:8508384-8508406 GGCCCAGAGGTGCAAGGAGCTGG + Intergenic
1136134891 16:28249717-28249739 GGCCAGGAGGTGGAAGGTACAGG + Intergenic
1136626165 16:31463426-31463448 GGCCCAAAGTTCAAAGGTGCTGG - Intronic
1137293002 16:47064982-47065004 GGCCTCCTGGTGGAAGGTGCTGG + Intergenic
1137557935 16:49484522-49484544 GGCCCCCAGGTGGGTGGGGCCGG + Intergenic
1137715276 16:50594757-50594779 GGCCCCCAGGTGTGAGCTGCTGG + Intronic
1138577165 16:57915374-57915396 GACTCCAGGGTGGAAGGTGAGGG + Intronic
1140326117 16:74005189-74005211 GGCCCCTGGGAGGAATGTGCAGG + Intergenic
1141177900 16:81732813-81732835 GGCCCACAGGGGGAAGGGGCTGG - Intergenic
1141311802 16:82920621-82920643 GGCCCCACTGTGGATGGTGCTGG + Intronic
1142193059 16:88726676-88726698 GGCCCCAGGGCGGTGGGTGCGGG + Intronic
1142208150 16:88793702-88793724 GGCCCCAAGCTGGCAGTTACTGG + Intergenic
1142208164 16:88793743-88793765 GGCCCCAAGCTGGCAGTTACTGG + Intergenic
1142208178 16:88793784-88793806 GGCCCCAAGCTGGCAGTTACTGG + Intergenic
1143180191 17:4979889-4979911 GGCTCCAAGGGGGCAGGTGAGGG + Exonic
1143732672 17:8889898-8889920 GGTCCCAAGGTGCACGGTCCAGG - Intronic
1144729645 17:17519141-17519163 GGCACACAGGTGGCAGGTGCTGG - Intronic
1145217102 17:21060866-21060888 GGCCCCAGGGTGGAAGGCGACGG - Intergenic
1145901630 17:28493940-28493962 GGCCACAGGGTGGAGGGTGGTGG - Intronic
1146961739 17:36986121-36986143 GGGGGCAAGGTGGAAGGTGTTGG + Intronic
1147558573 17:41495294-41495316 GGCCCCAGGGGAGAAGGTGGTGG - Intergenic
1148457350 17:47818212-47818234 GGCCCCAAGCTGGCAGGTCTAGG - Intronic
1151915961 17:77118173-77118195 GGCCGCACTGTGGAAGGGGCTGG + Intronic
1151934506 17:77253823-77253845 GGCCCTGAGGTGGAAGGAGCAGG - Intergenic
1152231016 17:79114266-79114288 GGCCCCAGGGTGGTAGAAGCAGG - Intronic
1152349014 17:79772920-79772942 GCCACCAAGGTGGATGGTGGTGG + Intergenic
1152425152 17:80214577-80214599 GGCCGCCAGGGGGAAGGGGCAGG + Intronic
1152515381 17:80820552-80820574 GGCCCCACGGAGGAATGTGAGGG - Intronic
1152569867 17:81116954-81116976 GGGCCCAGGGTGGAAGGCGGAGG - Exonic
1152928415 17:83098346-83098368 GACCCCAGGGTGAAAGGTGTAGG - Intergenic
1152945817 17:83196853-83196875 GGCCTCACTGTGGAAGGTGCAGG + Intergenic
1157322903 18:46647758-46647780 GCCCCCAAGGTACAGGGTGCAGG + Intronic
1157392233 18:47312470-47312492 GGCCCTATGGAGGAAGGAGCTGG + Intergenic
1157445729 18:47745565-47745587 GGCCCCAAGGTGGAGGTGGCTGG - Intergenic
1160678187 19:401443-401465 CACCCCACGGGGGAAGGTGCGGG + Intergenic
1160766029 19:808468-808490 GGCCCCGGGGTGGAGGGGGCAGG + Intronic
1161157431 19:2739934-2739956 GGCCCCCGGGAGGTAGGTGCGGG - Exonic
1161310895 19:3593332-3593354 GGCCCCAGGCTGGAAGGGACAGG - Exonic
1161515797 19:4695552-4695574 GGCGCTAAGGGGGAAGATGCGGG + Exonic
1162068502 19:8139932-8139954 GGCCCCCAGGTGCAAGGGGAGGG - Intronic
1162160604 19:8712131-8712153 GGCCCCATTTTGAAAGGTGCTGG + Intergenic
1162346216 19:10119519-10119541 GGTCCCAAGGAGGATGGCGCGGG + Intronic
1163426031 19:17241516-17241538 GCCCCCAAGCAGGAAGGTCCAGG + Intronic
1164840898 19:31391361-31391383 GGCCCCAAAGGGGAAGGTGTTGG + Intergenic
1165060756 19:33204238-33204260 GGTCCCGAGGTGGAGGGTTCTGG + Intronic
1166504257 19:43361597-43361619 GGCCCCAAGGATGAAGGCACTGG + Intronic
1166506202 19:43373161-43373183 GGCCCCAAGGATGAAGGCGCTGG - Intergenic
1166648241 19:44548950-44548972 GGCCTCACAGTGGTAGGTGCTGG + Intergenic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
1168353808 19:55690267-55690289 GGCCACAGGGAGGAGGGTGCAGG + Intronic
925970539 2:9103659-9103681 GGAGCCAAGCTGGAGGGTGCAGG + Intergenic
926212024 2:10878429-10878451 GCCCTCACTGTGGAAGGTGCTGG + Intergenic
926851104 2:17198265-17198287 GGCTCCAAGGTGTAAGGCACAGG + Intergenic
927099499 2:19777036-19777058 GGCACCAAGGAGGAAGTTCCAGG + Intergenic
927157012 2:20226238-20226260 TGCTCCACGGTGGAAGGTGGAGG - Intergenic
927857252 2:26535420-26535442 GGCTCCCAGGTGGGAAGTGCGGG + Intronic
931672794 2:64663780-64663802 GGCCCAAAGCAGGAAGGAGCAGG - Intronic
931766515 2:65461472-65461494 GGGCCCAAAGTGAAGGGTGCGGG + Intergenic
931837412 2:66113490-66113512 TGTCTCAAGGTGGAAAGTGCAGG + Intergenic
931879521 2:66553898-66553920 GGCCCCATGGTGGAAGGGGCAGG - Intronic
934706440 2:96484853-96484875 TATCCCAAGGTGGAAGGTGGAGG - Intergenic
935171289 2:100612961-100612983 GGCCCCAGGCTAGAAAGTGCTGG - Intergenic
936277864 2:111116458-111116480 GGTCCCAAGGAGGAAGGTGGAGG - Intronic
938180723 2:129179457-129179479 GGGGCCAAGGTGGCAGGGGCTGG + Intergenic
938789746 2:134666175-134666197 AGCCCCATGGTGGAAGGTGGTGG - Intronic
939371576 2:141307988-141308010 GGCCTGAAGGTGGCATGTGCAGG + Intronic
944413189 2:199461971-199461993 GGCGCCTGGGTGGAGGGTGCAGG + Intronic
944604514 2:201339775-201339797 GGCCCCAGGGTGGCATATGCTGG + Intronic
945483779 2:210370675-210370697 GGCCCCACAGTGGTATGTGCAGG + Intergenic
946407230 2:219498198-219498220 GGCGCCAGGGCGGAAGGTCCGGG - Intronic
947822969 2:233084844-233084866 GGCCCCAAGGGGGTCCGTGCTGG + Intronic
948567412 2:238895823-238895845 GGCTCCAAGCAGGAAGGAGCCGG + Intronic
948608676 2:239153012-239153034 GGTCCCAAGGTGGCGGGTGAAGG + Intronic
948610292 2:239162358-239162380 GGGCCCAAGCTGGAAAGGGCAGG - Intronic
948793834 2:240392248-240392270 GGCGGCAGGGTGGAGGGTGCAGG - Intergenic
1170004150 20:11647062-11647084 GGCTCCTGGGTGGAAGGTGGGGG + Intergenic
1171177424 20:23062952-23062974 GGACCCAAGGTGGAAAGCCCAGG - Intergenic
1171748858 20:29027605-29027627 GGCCCAGAGGTTGAAGGTGGAGG + Intergenic
1171935682 20:31272793-31272815 GGCCCCTATGTTGAATGTGCAGG - Intergenic
1171948156 20:31396820-31396842 CACCCCAAGGTAGCAGGTGCTGG - Intergenic
1172425947 20:34856252-34856274 GAACCCAAGGTGGTAGGTGCTGG - Intronic
1173264923 20:41470446-41470468 AGATCCAAGGTGGAAGATGCAGG - Intronic
1173553687 20:43950547-43950569 GGCCCTAAGATGGGAGCTGCCGG - Intronic
1174097094 20:48098057-48098079 GGGCCCAAGGAAGAAGGTGAGGG + Intergenic
1174171616 20:48621198-48621220 GGCCCCAAAGTGGAACTTCCCGG - Intergenic
1174272617 20:49380641-49380663 GACTCCAAGGTGGAGGGTGTGGG + Intronic
1174364567 20:50048648-50048670 GGCCCCAAGGCTGAGGGGGCTGG + Intergenic
1174385475 20:50186407-50186429 TGCCCCCAGGTGGCAGGTTCTGG - Intergenic
1174461991 20:50689786-50689808 GTCCCCAAGGTGGGTGGTGGGGG + Intronic
1175256735 20:57652404-57652426 GTCCCGAAGCTGGAGGGTGCAGG + Exonic
1175444483 20:59010617-59010639 TGCCCCAAGCTGGAAGGCGGTGG - Intergenic
1176029580 20:63005494-63005516 GTCACCGAGGTGGGAGGTGCCGG + Intergenic
1176106775 20:63393299-63393321 GGCCCAGAGGAGGAAGGAGCAGG + Intergenic
1176106823 20:63393429-63393451 GGCCCAGAGGAGGAAGGAGCAGG + Intergenic
1176423876 21:6535870-6535892 GTCCGCTAGGTGTAAGGTGCTGG + Intergenic
1176582330 21:8543254-8543276 GGCTCCTGGGTGGAAGGTGATGG - Intergenic
1178588926 21:33893013-33893035 GTCCCCCAGGAGGAAGCTGCAGG - Exonic
1179269624 21:39840632-39840654 GGCCCCAGGGGGAAGGGTGCAGG + Intergenic
1179699369 21:43144185-43144207 GTCCGCTAGGTGTAAGGTGCTGG + Intergenic
1180265165 22:10520302-10520324 GGCTCCTGGGTGGAAGGTGATGG - Intergenic
1180854205 22:19036110-19036132 AGCCCCTAGGTGGAGTGTGCAGG - Intergenic
1181079590 22:20405239-20405261 GGGCCAAGGCTGGAAGGTGCAGG - Intronic
1181843951 22:25690941-25690963 GTCCCCGAGGTGTCAGGTGCTGG - Intronic
1182303056 22:29349484-29349506 GACCCCAAGGTGGCAGGTAAAGG + Intronic
1182555290 22:31125710-31125732 GGCCCCAGGCCGGAAGGTGGGGG - Exonic
1184508660 22:44919036-44919058 GCCCCCCAGGAGGAGGGTGCAGG - Intronic
1184679419 22:46062079-46062101 GGCCCCGGGGCGGGAGGTGCGGG - Intronic
1185082645 22:48718362-48718384 GCCCCCAAGCAGGAAGGTGGTGG + Intronic
1185088475 22:48753220-48753242 GTCCCCAAGGTGAAGGGTCCGGG + Intronic
1185225209 22:49648151-49648173 GGCTCCAGGGAGGTAGGTGCAGG - Intronic
950118224 3:10464845-10464867 GGCCCTCAGGTGGAAGGCTCTGG + Intronic
950457058 3:13099144-13099166 GTGCCCCAGGTGGCAGGTGCGGG - Intergenic
952528635 3:34240638-34240660 TGCCCCAATTTGAAAGGTGCAGG + Intergenic
953385462 3:42503371-42503393 GACCCCAAGGTGGAAGCTGGTGG + Intronic
954107665 3:48418110-48418132 GGCCCAAAGGTGGGAGGTTGGGG - Intronic
954424260 3:50435031-50435053 GGCACCAGGGAGGAAGGGGCAGG + Intronic
956314529 3:67919761-67919783 GGCCCCAAGTGAGAGGGTGCAGG - Intergenic
960906118 3:122603289-122603311 GACCCCAAGGTGTAAGGGGTTGG + Intronic
961364947 3:126393887-126393909 GCTCCCAAGATGGAAGGAGCAGG - Intergenic
961448514 3:126992105-126992127 GGCCCCACGGTGGCAGGGGGAGG + Intronic
961781965 3:129325599-129325621 GGCCCCTAGGTGGGTGGTGTGGG - Intergenic
962251011 3:133836154-133836176 GGCCCAAGGGGGGAAGCTGCTGG + Intronic
962394264 3:135001203-135001225 AGCTGCAAGATGGAAGGTGCAGG - Intronic
962810495 3:138955336-138955358 GGCCCCGAGGAGGAGGCTGCTGG - Intergenic
964026351 3:152079452-152079474 GGCTCATAGGTGGAAGGGGCTGG - Intergenic
968605707 4:1534351-1534373 GGCAACAGGGTGGAAGGAGCTGG - Intergenic
968730175 4:2265795-2265817 AGGCCCAAGGTGGGAGGGGCAGG - Intergenic
968909629 4:3471035-3471057 GCCCTCGAGGTGGAAGGTGGTGG + Intronic
968953196 4:3705329-3705351 AGCCCCAGGTTGGGAGGTGCAGG + Intergenic
969521374 4:7679611-7679633 GGCGCGGAGGTGGAAGGGGCAGG + Intronic
970603324 4:17657535-17657557 GGCCACAAGGTAGAAGGCGCTGG + Intronic
970757457 4:19443479-19443501 GGCCCCAGGGAGGAATGTTCAGG - Intergenic
971714127 4:30153570-30153592 GGCTCCTAGGTGGAAGGGGGCGG - Intergenic
972245602 4:37243688-37243710 GGGCTCAAGGTGGACGGCGCAGG - Intergenic
972376397 4:38475941-38475963 GAAGCCAAGGTGGAAGTTGCCGG - Intergenic
974784309 4:66597645-66597667 GGCCCCCAGGTGGCATGTGTGGG - Intergenic
976422593 4:84863377-84863399 GGCCAGAAGGTGGAAAGTGTTGG - Intronic
976911052 4:90306158-90306180 GGCCCCAGGATGGAAGGACCGGG + Intronic
982166573 4:152618688-152618710 GGCCCCAATTTGGAAGGTGAAGG - Exonic
982190901 4:152854871-152854893 GGCCCCAGGGTGGTATATGCCGG + Intronic
986695783 5:10353649-10353671 GGCGCCGAGGCGGAAGGGGCGGG - Intergenic
986729703 5:10626139-10626161 GGGACCAGGGTGGAAGGAGCGGG - Intronic
987098384 5:14570363-14570385 GGCTCCATGGTGGTAGGTGGGGG - Intergenic
987152548 5:15057085-15057107 GGCCCCTAGGTGCAGGATGCAGG + Intergenic
988466937 5:31500216-31500238 GGCCCCAACTGGGGAGGTGCTGG + Intronic
992410366 5:76499463-76499485 GGCCCCAAGTAGGGAGGTGATGG - Intronic
997749261 5:136328876-136328898 AGTCCCAAGGTAGAAGGTGCAGG + Intronic
999294037 5:150446848-150446870 GGCCCAGAGGTGCAAGGAGCTGG - Exonic
999474231 5:151883730-151883752 GGCCACAAGGTGGATGCTACTGG + Intronic
1001770946 5:174295399-174295421 GGCCTCAGTGTGGAAGGTGCCGG + Intergenic
1002496241 5:179613708-179613730 GCCCACAAGGTGGAGGTTGCAGG + Intergenic
1005147221 6:22705293-22705315 GGCTCCAAGGTGGCTGATGCTGG + Intergenic
1005150322 6:22741398-22741420 GGCCTCACGGTGCAATGTGCAGG + Intergenic
1005840422 6:29741659-29741681 GGCACCAAGTGGGAAAGTGCTGG + Intergenic
1005853655 6:29843478-29843500 TGCCCCAAGGGGGCAGCTGCTGG + Intergenic
1007810893 6:44485003-44485025 GTCCCCTAGGTGGAAAGTCCTGG - Intergenic
1008687435 6:53941330-53941352 GGACCCAGGGTGGAAGGTCCGGG + Intronic
1008716284 6:54294013-54294035 GGCACCCAGGTAGAAGGGGCAGG - Intergenic
1010197956 6:73258650-73258672 GGGCCAAAGGCGGAAGGTGGAGG + Intronic
1010721125 6:79284059-79284081 GGCCCTGAGGTGGAATGTGGGGG + Intergenic
1011283874 6:85704107-85704129 GGCCTCAGGGTGCAAGGTGAAGG - Intergenic
1012062858 6:94511036-94511058 GGACCCACGGTGGAGGGAGCAGG - Intergenic
1016873105 6:148838247-148838269 GGCCCCAGGTTGGAAAGGGCAGG + Intronic
1018198847 6:161377392-161377414 GGCCCCACGGTGGTAGTGGCCGG + Intronic
1018713334 6:166513339-166513361 AACACCAAGGTGGAGGGTGCGGG + Intronic
1019387031 7:763121-763143 GGCCCCAAGAAGGAAGGGGAGGG - Intronic
1019485270 7:1286299-1286321 GGCCCTGAGGTGGGAGGGGCCGG + Intergenic
1019701259 7:2475951-2475973 GGCCCCCGGCTGGAAGCTGCTGG - Exonic
1020014846 7:4824980-4825002 GGCCCCAGGTTGGCAGGTGGGGG - Intronic
1020204713 7:6105365-6105387 GGCCCCCAGGCCGAAGGGGCGGG - Intronic
1020763754 7:12296434-12296456 GTGCCCAAGGTGGAAGCTGGTGG + Intergenic
1021891281 7:25188435-25188457 GGACCCAAGTTGGAAGGGCCAGG + Intergenic
1024539942 7:50468092-50468114 GGCCCCCATGTTGCAGGTGCTGG + Intronic
1024962412 7:54991480-54991502 GGCCGCTGGGTGGAAGGTGATGG + Intergenic
1025068043 7:55874676-55874698 GGCCCCCAGGTGGCATGTGAGGG + Intergenic
1026601638 7:71782370-71782392 TGACCCATGGTGGAAGGTGAAGG - Exonic
1026960471 7:74404445-74404467 GGCCCCCAGGTTCAAGGTGTTGG + Exonic
1027938250 7:84637051-84637073 GGCCCCAAAGTGGCATATGCTGG + Intergenic
1029144937 7:98439155-98439177 GGCCCCAATCTGGAATGTGATGG - Intergenic
1030605253 7:111633193-111633215 GGTCCCCAGGTGGAAGGTTTGGG + Intergenic
1031951486 7:127897150-127897172 GGCCCAAAGTTGGAGGGTGCTGG - Intronic
1031983475 7:128146335-128146357 GGCCTCAAGTTGGAAGGGGAAGG + Intergenic
1032043920 7:128586488-128586510 TGACCCCAGGTGGAAGGTGTAGG - Intergenic
1033412576 7:141132555-141132577 GGCCCCCAGGTGGCACGTGCAGG - Intronic
1037859867 8:22397608-22397630 GGCCTCAGGGTGGAAGGAGGAGG - Intronic
1038012676 8:23487286-23487308 GGCACCAAGGTGAAATGGGCGGG - Intergenic
1038149194 8:24927672-24927694 GGCCCCAGGGCAGAAGCTGCTGG - Intergenic
1040336992 8:46421096-46421118 GGCCACAGGGTGGTATGTGCTGG + Intergenic
1040360433 8:46659253-46659275 GGCCCCCAGGTGGCATGTGAGGG - Intergenic
1041192011 8:55364314-55364336 GGCCCGGGGGTGGAATGTGCTGG - Intronic
1041264735 8:56053206-56053228 GGCTCCCAGGTGCAGGGTGCTGG + Intergenic
1043962621 8:86434380-86434402 AGACCCAAGGTGGAAGCTGAAGG - Intronic
1046422787 8:114006493-114006515 GGCCCCAAGGTGGACAGGGCTGG + Intergenic
1047697309 8:127416207-127416229 GGCACCAGGGGGGACGGTGCAGG - Exonic
1048345044 8:133570008-133570030 GGCCCCAAGGTGGAAGGTGCTGG - Intronic
1049194486 8:141308033-141308055 GGCGCCCAGGTGCGAGGTGCAGG + Intronic
1049278740 8:141733213-141733235 GGTGGCAAGGTGGAAGGGGCAGG + Intergenic
1049846492 8:144804451-144804473 GTCCCCAAGGTGTCAGGGGCCGG + Intronic
1049861267 8:144901093-144901115 GGGCCCAAGGGGGTAGGGGCGGG + Intronic
1052987094 9:34495712-34495734 GGCCCATAGGTAGAAGATGCAGG + Intronic
1055670961 9:78605788-78605810 GGCTGCAAGGGGCAAGGTGCTGG + Intergenic
1056002497 9:82231477-82231499 GGCTCCATGGTGGCAGGTGCTGG - Intergenic
1056183793 9:84111675-84111697 GGCCCCAAGGTTGAAATTGTGGG - Intergenic
1056556442 9:87693984-87694006 GGCCCCAGGGTGGTATATGCTGG + Intronic
1056689858 9:88798750-88798772 TGCCCCAAGGTGGGTGGTGAGGG + Intergenic
1057302517 9:93895001-93895023 GTCCCCAAGGTGGAAGCAGGCGG - Intergenic
1057500474 9:95593755-95593777 TCCCCTAAGTTGGAAGGTGCAGG + Intergenic
1057895223 9:98903744-98903766 AGGCCCAAAGTGGAGGGTGCTGG - Intergenic
1059396769 9:114039425-114039447 GCCCAGAAGGTGGAAGTTGCAGG - Intronic
1060401880 9:123354231-123354253 GGCCACAAGGTGGAGTGTGGCGG + Intergenic
1060625855 9:125110664-125110686 GGCCTCATGGTGGAAGGTGAAGG - Intronic
1060818320 9:126647446-126647468 GGCGCCAAGGTGAAAGGAACGGG - Intronic
1061295423 9:129674394-129674416 GCCCCCAAACTGGAAGGTCCAGG - Intronic
1061789584 9:133052003-133052025 GGCCGAAGGGTGGAAGCTGCTGG + Intronic
1062049433 9:134439439-134439461 GGCCCCAGGGTGGAAGGTCCTGG - Intronic
1062151432 9:135021205-135021227 GCCCTCAAGCTGGAAGGTTCTGG - Intergenic
1062267775 9:135695245-135695267 GGCACCAGGCTGGAAGGTTCTGG + Exonic
1062713278 9:137988299-137988321 GGCGACAAGGTGGCAGGTGTGGG + Intronic
1195276050 X:103281834-103281856 GGCCCCTAGGTGGATAGGGCTGG + Intergenic
1196875080 X:120149364-120149386 GGAACCAATGTGCAAGGTGCAGG + Intergenic
1200080790 X:153575435-153575457 GGTCCCCAGGTGGGATGTGCCGG + Intronic
1200232160 X:154449500-154449522 AGCCCAAAGGTGGAGGGTGCTGG + Intronic