ID: 1048346507

View in Genome Browser
Species Human (GRCh38)
Location 8:133579654-133579676
Sequence ACTGTAATACAGCCTCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048346507_1048346511 30 Left 1048346507 8:133579654-133579676 CCTGCCTGAGGCTGTATTACAGT No data
Right 1048346511 8:133579707-133579729 TTGCCTAATGACGCTTTTCTTGG No data
1048346507_1048346509 -10 Left 1048346507 8:133579654-133579676 CCTGCCTGAGGCTGTATTACAGT No data
Right 1048346509 8:133579667-133579689 GTATTACAGTGAACTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048346507 Original CRISPR ACTGTAATACAGCCTCAGGC AGG (reversed) Intergenic
No off target data available for this crispr