ID: 1048346511

View in Genome Browser
Species Human (GRCh38)
Location 8:133579707-133579729
Sequence TTGCCTAATGACGCTTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048346507_1048346511 30 Left 1048346507 8:133579654-133579676 CCTGCCTGAGGCTGTATTACAGT No data
Right 1048346511 8:133579707-133579729 TTGCCTAATGACGCTTTTCTTGG No data
1048346508_1048346511 26 Left 1048346508 8:133579658-133579680 CCTGAGGCTGTATTACAGTGAAC No data
Right 1048346511 8:133579707-133579729 TTGCCTAATGACGCTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048346511 Original CRISPR TTGCCTAATGACGCTTTTCT TGG Intergenic
No off target data available for this crispr