ID: 1048351229

View in Genome Browser
Species Human (GRCh38)
Location 8:133618341-133618363
Sequence ACCATACAGCATACTTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048351229_1048351239 25 Left 1048351229 8:133618341-133618363 CCCTCATAAGTATGCTGTATGGT No data
Right 1048351239 8:133618389-133618411 CTTAGGGAATCAGGGAGTGGAGG No data
1048351229_1048351240 26 Left 1048351229 8:133618341-133618363 CCCTCATAAGTATGCTGTATGGT No data
Right 1048351240 8:133618390-133618412 TTAGGGAATCAGGGAGTGGAGGG No data
1048351229_1048351238 22 Left 1048351229 8:133618341-133618363 CCCTCATAAGTATGCTGTATGGT No data
Right 1048351238 8:133618386-133618408 TGACTTAGGGAATCAGGGAGTGG No data
1048351229_1048351237 17 Left 1048351229 8:133618341-133618363 CCCTCATAAGTATGCTGTATGGT No data
Right 1048351237 8:133618381-133618403 TGTGTTGACTTAGGGAATCAGGG No data
1048351229_1048351236 16 Left 1048351229 8:133618341-133618363 CCCTCATAAGTATGCTGTATGGT No data
Right 1048351236 8:133618380-133618402 CTGTGTTGACTTAGGGAATCAGG No data
1048351229_1048351233 -9 Left 1048351229 8:133618341-133618363 CCCTCATAAGTATGCTGTATGGT No data
Right 1048351233 8:133618355-133618377 CTGTATGGTGAGTGTGAGGGTGG No data
1048351229_1048351234 8 Left 1048351229 8:133618341-133618363 CCCTCATAAGTATGCTGTATGGT No data
Right 1048351234 8:133618372-133618394 GGGTGGCGCTGTGTTGACTTAGG No data
1048351229_1048351235 9 Left 1048351229 8:133618341-133618363 CCCTCATAAGTATGCTGTATGGT No data
Right 1048351235 8:133618373-133618395 GGTGGCGCTGTGTTGACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048351229 Original CRISPR ACCATACAGCATACTTATGA GGG (reversed) Intergenic
No off target data available for this crispr