ID: 1048351238

View in Genome Browser
Species Human (GRCh38)
Location 8:133618386-133618408
Sequence TGACTTAGGGAATCAGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048351229_1048351238 22 Left 1048351229 8:133618341-133618363 CCCTCATAAGTATGCTGTATGGT No data
Right 1048351238 8:133618386-133618408 TGACTTAGGGAATCAGGGAGTGG No data
1048351230_1048351238 21 Left 1048351230 8:133618342-133618364 CCTCATAAGTATGCTGTATGGTG No data
Right 1048351238 8:133618386-133618408 TGACTTAGGGAATCAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048351238 Original CRISPR TGACTTAGGGAATCAGGGAG TGG Intergenic
No off target data available for this crispr