ID: 1048353995

View in Genome Browser
Species Human (GRCh38)
Location 8:133638642-133638664
Sequence TTGTGTTCCCTGAACAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048353995_1048353997 10 Left 1048353995 8:133638642-133638664 CCATGTTTGTTCAGGGAACACAA No data
Right 1048353997 8:133638675-133638697 TTGTGAGTGCACATACCCCATGG No data
1048353995_1048354001 27 Left 1048353995 8:133638642-133638664 CCATGTTTGTTCAGGGAACACAA No data
Right 1048354001 8:133638692-133638714 CCATGGTCTTTTCGAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048353995 Original CRISPR TTGTGTTCCCTGAACAAACA TGG (reversed) Intergenic
No off target data available for this crispr