ID: 1048356345

View in Genome Browser
Species Human (GRCh38)
Location 8:133657031-133657053
Sequence CATCAGAACCTGTGACTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048356345_1048356353 30 Left 1048356345 8:133657031-133657053 CCACATAGTCACAGGTTCTGATG No data
Right 1048356353 8:133657084-133657106 CCTTTATTCAGCCTCCCACCGGG No data
1048356345_1048356350 7 Left 1048356345 8:133657031-133657053 CCACATAGTCACAGGTTCTGATG No data
Right 1048356350 8:133657061-133657083 AGGACATATACATCTTCAGGTGG No data
1048356345_1048356349 4 Left 1048356345 8:133657031-133657053 CCACATAGTCACAGGTTCTGATG No data
Right 1048356349 8:133657058-133657080 ATTAGGACATATACATCTTCAGG No data
1048356345_1048356351 29 Left 1048356345 8:133657031-133657053 CCACATAGTCACAGGTTCTGATG No data
Right 1048356351 8:133657083-133657105 GCCTTTATTCAGCCTCCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048356345 Original CRISPR CATCAGAACCTGTGACTATG TGG (reversed) Intergenic
No off target data available for this crispr