ID: 1048356426

View in Genome Browser
Species Human (GRCh38)
Location 8:133657489-133657511
Sequence GGGCTCCAATTTAAAACTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048356421_1048356426 -3 Left 1048356421 8:133657469-133657491 CCATGAGTTGAATCCTCTGAGGG No data
Right 1048356426 8:133657489-133657511 GGGCTCCAATTTAAAACTTGGGG No data
1048356419_1048356426 19 Left 1048356419 8:133657447-133657469 CCAGGTTGGAGTCAGGCACAGGC No data
Right 1048356426 8:133657489-133657511 GGGCTCCAATTTAAAACTTGGGG No data
1048356416_1048356426 23 Left 1048356416 8:133657443-133657465 CCCACCAGGTTGGAGTCAGGCAC No data
Right 1048356426 8:133657489-133657511 GGGCTCCAATTTAAAACTTGGGG No data
1048356417_1048356426 22 Left 1048356417 8:133657444-133657466 CCACCAGGTTGGAGTCAGGCACA No data
Right 1048356426 8:133657489-133657511 GGGCTCCAATTTAAAACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048356426 Original CRISPR GGGCTCCAATTTAAAACTTG GGG Intergenic
No off target data available for this crispr