ID: 1048361922

View in Genome Browser
Species Human (GRCh38)
Location 8:133704916-133704938
Sequence GTTCATCCCATGCCAATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048361916_1048361922 11 Left 1048361916 8:133704882-133704904 CCACTTCTCAACTCACCTGTTAC No data
Right 1048361922 8:133704916-133704938 GTTCATCCCATGCCAATGAAGGG No data
1048361920_1048361922 -4 Left 1048361920 8:133704897-133704919 CCTGTTACAGTGCTCAGGGGTTC No data
Right 1048361922 8:133704916-133704938 GTTCATCCCATGCCAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048361922 Original CRISPR GTTCATCCCATGCCAATGAA GGG Intergenic
No off target data available for this crispr