ID: 1048367960

View in Genome Browser
Species Human (GRCh38)
Location 8:133754886-133754908
Sequence ATCCTATCCATTATAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048367954_1048367960 14 Left 1048367954 8:133754849-133754871 CCCATCAACAAACACGAGTATCC 0: 1
1: 0
2: 2
3: 8
4: 52
Right 1048367960 8:133754886-133754908 ATCCTATCCATTATAGTGGGCGG No data
1048367957_1048367960 -10 Left 1048367957 8:133754873-133754895 CCTATCTATCACAATCCTATCCA 0: 5
1: 2
2: 4
3: 19
4: 216
Right 1048367960 8:133754886-133754908 ATCCTATCCATTATAGTGGGCGG No data
1048367955_1048367960 13 Left 1048367955 8:133754850-133754872 CCATCAACAAACACGAGTATCCT 0: 1
1: 0
2: 2
3: 7
4: 75
Right 1048367960 8:133754886-133754908 ATCCTATCCATTATAGTGGGCGG No data
1048367956_1048367960 -7 Left 1048367956 8:133754870-133754892 CCTCCTATCTATCACAATCCTAT No data
Right 1048367960 8:133754886-133754908 ATCCTATCCATTATAGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048367960 Original CRISPR ATCCTATCCATTATAGTGGG CGG Intergenic
No off target data available for this crispr