ID: 1048372291

View in Genome Browser
Species Human (GRCh38)
Location 8:133789718-133789740
Sequence AAATGTATTTAACACCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048372291_1048372293 9 Left 1048372291 8:133789718-133789740 CCAAGTAGGTGTTAAATACATTT No data
Right 1048372293 8:133789750-133789772 ATAACTCTCCTGCTGTATTCTGG No data
1048372291_1048372294 10 Left 1048372291 8:133789718-133789740 CCAAGTAGGTGTTAAATACATTT No data
Right 1048372294 8:133789751-133789773 TAACTCTCCTGCTGTATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048372291 Original CRISPR AAATGTATTTAACACCTACT TGG (reversed) Intergenic
No off target data available for this crispr