ID: 1048374210

View in Genome Browser
Species Human (GRCh38)
Location 8:133808155-133808177
Sequence ATCTTCCAATGGGAGAACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048374206_1048374210 -10 Left 1048374206 8:133808142-133808164 CCCTGGGGGAGAAATCTTCCAAT No data
Right 1048374210 8:133808155-133808177 ATCTTCCAATGGGAGAACTAAGG No data
1048374200_1048374210 14 Left 1048374200 8:133808118-133808140 CCCAGCGGGGAATAGGGGAAGTC No data
Right 1048374210 8:133808155-133808177 ATCTTCCAATGGGAGAACTAAGG No data
1048374198_1048374210 19 Left 1048374198 8:133808113-133808135 CCTCACCCAGCGGGGAATAGGGG No data
Right 1048374210 8:133808155-133808177 ATCTTCCAATGGGAGAACTAAGG No data
1048374201_1048374210 13 Left 1048374201 8:133808119-133808141 CCAGCGGGGAATAGGGGAAGTCT No data
Right 1048374210 8:133808155-133808177 ATCTTCCAATGGGAGAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048374210 Original CRISPR ATCTTCCAATGGGAGAACTA AGG Intergenic
No off target data available for this crispr