ID: 1048377257

View in Genome Browser
Species Human (GRCh38)
Location 8:133833654-133833676
Sequence GTGTGGGTATGGAGGGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048377257_1048377268 8 Left 1048377257 8:133833654-133833676 CCCAATTCCCTCCATACCCACAC No data
Right 1048377268 8:133833685-133833707 AGGCCTCCACATAGGCCCTCAGG No data
1048377257_1048377266 0 Left 1048377257 8:133833654-133833676 CCCAATTCCCTCCATACCCACAC No data
Right 1048377266 8:133833677-133833699 CAAGCCACAGGCCTCCACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048377257 Original CRISPR GTGTGGGTATGGAGGGAATT GGG (reversed) Intergenic
No off target data available for this crispr