ID: 1048378561

View in Genome Browser
Species Human (GRCh38)
Location 8:133844340-133844362
Sequence CCACCTTAGAGACTGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 203}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048378561_1048378563 -9 Left 1048378561 8:133844340-133844362 CCAGGAAACAGTCTCTAAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 203
Right 1048378563 8:133844354-133844376 CTAAGGTGGAACTTACTATGTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1048378561_1048378569 16 Left 1048378561 8:133844340-133844362 CCAGGAAACAGTCTCTAAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 203
Right 1048378569 8:133844379-133844401 CATTTATTAAGGGGTGTCATTGG 0: 1
1: 0
2: 1
3: 10
4: 141
1048378561_1048378564 -8 Left 1048378561 8:133844340-133844362 CCAGGAAACAGTCTCTAAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 203
Right 1048378564 8:133844355-133844377 TAAGGTGGAACTTACTATGTGGG 0: 1
1: 0
2: 1
3: 4
4: 101
1048378561_1048378567 6 Left 1048378561 8:133844340-133844362 CCAGGAAACAGTCTCTAAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 203
Right 1048378567 8:133844369-133844391 CTATGTGGGGCATTTATTAAGGG 0: 1
1: 0
2: 0
3: 14
4: 138
1048378561_1048378566 5 Left 1048378561 8:133844340-133844362 CCAGGAAACAGTCTCTAAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 203
Right 1048378566 8:133844368-133844390 ACTATGTGGGGCATTTATTAAGG 0: 1
1: 0
2: 0
3: 11
4: 115
1048378561_1048378570 17 Left 1048378561 8:133844340-133844362 CCAGGAAACAGTCTCTAAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 203
Right 1048378570 8:133844380-133844402 ATTTATTAAGGGGTGTCATTGGG 0: 1
1: 0
2: 0
3: 19
4: 218
1048378561_1048378568 7 Left 1048378561 8:133844340-133844362 CCAGGAAACAGTCTCTAAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 203
Right 1048378568 8:133844370-133844392 TATGTGGGGCATTTATTAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 164
1048378561_1048378565 -7 Left 1048378561 8:133844340-133844362 CCAGGAAACAGTCTCTAAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 203
Right 1048378565 8:133844356-133844378 AAGGTGGAACTTACTATGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048378561 Original CRISPR CCACCTTAGAGACTGTTTCC TGG (reversed) Intergenic
900459446 1:2795378-2795400 CCACCTTAGAGTCTCTTGTCCGG - Intronic
900668893 1:3836940-3836962 CCACCTCAATGACTGTTTACTGG + Intronic
902574273 1:17367517-17367539 CCATCTAAGAATCTGTTTCCAGG - Intergenic
903856094 1:26338218-26338240 ACCCCTTGGAGACTGCTTCCTGG - Intronic
904336552 1:29801841-29801863 CCAGCTCAGGGACTGTTTCAGGG + Intergenic
905479863 1:38254354-38254376 CCATCTCAGAGTCTGTCTCCAGG - Intergenic
905956941 1:42005044-42005066 CCACCTTAGGGACTTTGCCCTGG + Intronic
906043149 1:42805105-42805127 CCACCTTTCAGATTGTTTCATGG - Intergenic
906193250 1:43912699-43912721 GCTCCTGAGAGAATGTTTCCTGG - Intronic
908899566 1:68940778-68940800 CTAACTTATAAACTGTTTCCTGG + Intergenic
915420781 1:155779726-155779748 CCTCCTGGGAGACTTTTTCCAGG - Intronic
915420910 1:155780672-155780694 CCTCCTGAGAGACTGTTTCCAGG + Intronic
916292066 1:163177809-163177831 CCTCTTTAAAGACTGTTGCCAGG + Intronic
918187477 1:182141133-182141155 GCACCTTAGAGAATTTCTCCAGG - Intergenic
919044691 1:192435894-192435916 TCACCTCAGAGCCTGTTTCCTGG + Intergenic
919596128 1:199564937-199564959 CCACCTTAGAGTGTGATTGCTGG - Intergenic
921286720 1:213615897-213615919 CCACCTTAGTGACTGTTCTGGGG + Intergenic
1065708225 10:28490728-28490750 CCATCTCAGATACTGCTTCCTGG + Intergenic
1066546399 10:36505047-36505069 CCCACATAGAGCCTGTTTCCTGG + Intergenic
1067731273 10:48813132-48813154 CCAACTTAGAAACTATTTCTTGG + Intronic
1070730211 10:78822320-78822342 CCATCTCAGAGTTTGTTTCCTGG - Intergenic
1071010801 10:80938116-80938138 CCATCTCAGAGCCTGTTTCCTGG + Intergenic
1072729251 10:97834105-97834127 CCTCTTCAGAGTCTGTTTCCAGG + Intergenic
1074038392 10:109763722-109763744 CCATCTTAGAGTCAATTTCCTGG - Intergenic
1075322126 10:121499785-121499807 CCACCTTGGAGCCTGATGCCGGG - Intronic
1077862730 11:6197920-6197942 CCACCTGATAGTCTCTTTCCTGG + Intergenic
1078416930 11:11173580-11173602 CCATCTCATAGTCTGTTTCCTGG + Intergenic
1079222258 11:18573492-18573514 CAAGCTTTTAGACTGTTTCCTGG - Intronic
1080111417 11:28572350-28572372 CCAAATTGGAGACTGTTTCCTGG - Intergenic
1080131315 11:28798210-28798232 CCACTTTAGAAATTATTTCCAGG + Intergenic
1081501366 11:43669924-43669946 CAATCTCAGAGTCTGTTTCCTGG - Intronic
1081706770 11:45186777-45186799 CCACCCTATGGACTGTTTCGAGG - Intronic
1083888089 11:65582379-65582401 CCACCTCAGTCTCTGTTTCCAGG - Exonic
1086846639 11:91758053-91758075 CCACCTTAGAGTTTTTTTCCAGG - Intergenic
1087120037 11:94564158-94564180 CCACCTCAGAGATTCATTCCAGG + Intronic
1087181762 11:95149214-95149236 TCATCTCAGAGACTGATTCCTGG - Intergenic
1088167909 11:106959979-106960001 CCATGTTGGAGTCTGTTTCCTGG + Intronic
1088171577 11:107003797-107003819 CCTTCTTAGAGTCTGCTTCCTGG - Intronic
1088906517 11:114159211-114159233 CCACCTGAGATGCTGCTTCCAGG + Intronic
1089806186 11:121092974-121092996 CCACCTTAGCATCTGCTTCCTGG - Intergenic
1091005972 11:131954132-131954154 CCACCTGAGAGGATGTCTCCTGG + Intronic
1091166993 11:133487348-133487370 CCACCTTAGGGCTTGTGTCCTGG + Intronic
1095743535 12:45632786-45632808 CCACCTCAGAGCCTTTTCCCCGG - Intergenic
1096053163 12:48628798-48628820 CCTCCTTAGTGAGTGTGTCCTGG - Intergenic
1096785641 12:54015740-54015762 CCCCCATAGAGACTATTTGCCGG - Intronic
1096911869 12:54991968-54991990 CCACTTTTGAGATTGTTTTCAGG - Intergenic
1097137839 12:56874314-56874336 CCAGCTTGGAAACTGTTTACTGG - Intergenic
1098755635 12:74359739-74359761 CCACCTTAGAGAATATTTCATGG - Intergenic
1098775253 12:74605125-74605147 CCACCTTAGTAACTCTTTTCTGG - Intergenic
1098818258 12:75195876-75195898 CAACCTCAGGGACTGTCTCCTGG + Intronic
1099957841 12:89368630-89368652 CCACCTGATGGACTGTTTCAAGG - Intergenic
1101276396 12:103206328-103206350 CCAACTTAGAGTCTGTTTGCAGG + Intergenic
1102166429 12:110810338-110810360 CTATCTTAGAGTCTGCTTCCTGG + Intergenic
1102360608 12:112284508-112284530 CCACCTTTGGGAATCTTTCCTGG - Intronic
1103041188 12:117696789-117696811 ACACCTAAGAAACTGTTTCTAGG + Intronic
1103461690 12:121109930-121109952 CCATCTTAGAGACTGTTTGGTGG - Intergenic
1103879067 12:124152155-124152177 CCACCCTGGAGAGTGTGTCCAGG - Intronic
1104351525 12:128048118-128048140 CCATCTTAGACACATTTTCCAGG + Intergenic
1109356312 13:61233298-61233320 GCACCCTAGAGACTGTTCCTGGG + Intergenic
1113802543 13:113094095-113094117 TCACTTTAGAAACTGCTTCCCGG + Intronic
1114595572 14:23909030-23909052 CCATCTCAGAGTCTGCTTCCTGG - Intergenic
1114826812 14:26090604-26090626 CCATCTCAGAGACTTTTTCCAGG + Intergenic
1115330860 14:32196491-32196513 CCACCTTCCAAAATGTTTCCGGG - Intergenic
1115617774 14:35112641-35112663 TAACCTGAGAGACTGTTTCAGGG + Intronic
1116626930 14:47277241-47277263 TCATCTCAGAAACTGTTTCCAGG + Intronic
1116866125 14:50033088-50033110 TCAGCATAGAGACTGTTTTCTGG - Intergenic
1118891869 14:69916718-69916740 CCTTCTCAGAGACTCTTTCCTGG + Intronic
1122199532 14:100114099-100114121 GCACCTAAGAGACAGTTTGCAGG + Intronic
1123186501 14:106522507-106522529 CCACCAGAGAGTCTGTTCCCTGG + Intergenic
1123200793 14:106661847-106661869 CCACCAGAGAGTCTGTTCCCTGG + Intergenic
1124649463 15:31464371-31464393 GCACCTCAGAGACTGGTTCAGGG - Intergenic
1127291166 15:57572778-57572800 CCCTCTTAAAGACTGTTTCTGGG + Intergenic
1128468549 15:67932909-67932931 CCATCTCAGAGTCTGCTTCCAGG + Intergenic
1128499343 15:68216649-68216671 CCATTATAGAGAATGTTTCCTGG - Intronic
1130080437 15:80728113-80728135 CCACCTTGTAAACTGTTGCCAGG + Intronic
1131994391 15:98120137-98120159 CCATCTCAAAGCCTGTTTCCTGG - Intergenic
1132465267 16:74554-74576 CCAGCTCAGAGCCTGTGTCCAGG + Intronic
1133009727 16:2904484-2904506 CCACCTTAGAGCCGGTGTCTGGG - Intergenic
1133829569 16:9309278-9309300 CCTCCTGAGAGTCTGTTTCATGG - Intergenic
1134023569 16:10938454-10938476 CGCCCTTAGTCACTGTTTCCTGG + Intronic
1134771673 16:16814682-16814704 ACACCTGAGAGCCTGTTTCCAGG - Intergenic
1139526325 16:67518902-67518924 CTTCCTTTGAGACAGTTTCCTGG - Intronic
1141094501 16:81153470-81153492 CCATCTGAGAGCCTGCTTCCCGG + Intergenic
1141101935 16:81203752-81203774 CCACAACAGAGTCTGTTTCCTGG + Intergenic
1142614128 17:1125184-1125206 CCACCTGAGGGACTGGCTCCTGG - Exonic
1147406724 17:40217771-40217793 CCACCTCAGGGACTGTGTACTGG - Intergenic
1147476331 17:40715223-40715245 CCATCTCAGAGTCTGTTTCCAGG - Intergenic
1147516338 17:41121690-41121712 CCATCTCAGTGACTGCTTCCTGG - Intergenic
1148542937 17:48494209-48494231 CCACCAAGGAGACTGATTCCTGG + Intergenic
1149589690 17:57819206-57819228 CTATCTCAGAGTCTGTTTCCAGG + Intergenic
1149651839 17:58280586-58280608 CCACCTTGGGAACTGTTACCTGG + Exonic
1150796138 17:68238795-68238817 CCACTTTAGTTACTCTTTCCCGG - Intergenic
1152148883 17:78586593-78586615 CCACCTCATAGATTGATTCCGGG - Intergenic
1156611594 18:38731326-38731348 CCATCTCAGAGCCTGTTTCCTGG + Intergenic
1156744634 18:40374147-40374169 CCACCTGAGAAATTGTTTCATGG - Intergenic
1156848549 18:41698734-41698756 CCCCCTTGGAGACTATTCCCAGG - Intergenic
1157963110 18:52179045-52179067 CCATCTCAGAGTCTGCTTCCTGG - Intergenic
1164530782 19:29046610-29046632 CCATCTCAGAGCCTGTTCCCTGG - Intergenic
1165473526 19:36016748-36016770 ACACCCTAAAGACTGTTTCTGGG + Intronic
1166423614 19:42656862-42656884 CCTCTTTAGAGACTGGATCCTGG + Intronic
1167162666 19:47778383-47778405 CCACCCTTGAGGCTGATTCCGGG + Intergenic
925546773 2:5024835-5024857 CCTCCTTAGAGACACTTCCCAGG + Intergenic
929028120 2:37625205-37625227 CCTCCAGGGAGACTGTTTCCAGG - Intergenic
929093949 2:38246483-38246505 CCATCTGAGAGTCTATTTCCTGG + Intergenic
930093697 2:47550711-47550733 GCACCTTAAAGATTGTTTTCTGG - Intronic
931368030 2:61636388-61636410 TCATCTCAGAGTCTGTTTCCTGG - Intergenic
931986110 2:67744253-67744275 CCACTGTAGACCCTGTTTCCCGG + Intergenic
933154588 2:78959116-78959138 CCTCCTTCTAGACTGTTTTCTGG - Intergenic
934732120 2:96666005-96666027 CCACCCTGGAGACTGTGTTCTGG - Intergenic
935707266 2:105868001-105868023 CCATTTTAGTGTCTGTTTCCTGG + Intronic
935804889 2:106735499-106735521 CCACCTGAGAGTTTCTTTCCAGG + Intergenic
935933967 2:108161463-108161485 AAACCTTAGAGCCTGTGTCCCGG - Intergenic
938099098 2:128486103-128486125 CCACCTCACAGTCTGTTTCTGGG - Intergenic
939452529 2:142392797-142392819 CTACCCAAGAGACTGGTTCCTGG - Intergenic
939706221 2:145457073-145457095 TCAACTTAGACACTGTGTCCTGG + Intergenic
939881614 2:147637934-147637956 ACACCTTGGAGACTGTTTTCTGG - Intergenic
942194418 2:173503339-173503361 CCATCTCAGAGACTGTTTTCTGG + Intergenic
943665896 2:190607895-190607917 TCATCTCAGAGTCTGTTTCCAGG - Intergenic
944222959 2:197320566-197320588 CCATCTCAGAGACTGTTGCCTGG + Intergenic
945108205 2:206337109-206337131 CCATCTCAGAGTCTGTTTCCAGG - Intergenic
1170220586 20:13937449-13937471 CCACCTCCTAGATTGTTTCCTGG - Intronic
1173565541 20:44035786-44035808 CCATCTCGGAGTCTGTTTCCAGG - Intronic
1174481771 20:50836360-50836382 CCCCCTTAGAGTCAGTTTCAAGG + Intronic
1177129525 21:17239740-17239762 CCACCTCAAATTCTGTTTCCAGG + Intergenic
1177405531 21:20662792-20662814 CCACCTCACAGATTGATTCCAGG - Intergenic
1178521061 21:33288909-33288931 CTATCTTAGAGTCTGCTTCCTGG - Intronic
1178915613 21:36704220-36704242 TTATCTTAGAAACTGTTTCCCGG + Intronic
1179134714 21:38669308-38669330 CCTGCCTAGAGACTGTTTACTGG + Intergenic
1179255303 21:39710773-39710795 CCATCTCAGAGTCTGTTTCCTGG - Intergenic
1179272364 21:39861358-39861380 CCACCTTAGAGGCAGCTTCCAGG - Intergenic
1180833667 22:18919221-18919243 CCACCTAAGGGGCTCTTTCCTGG + Intronic
1181066162 22:20307033-20307055 CCACCTAAGGGGCTCTTTCCTGG - Intergenic
1181402935 22:22662302-22662324 CCATCTCAGAGTCTGTTTCCAGG + Intergenic
1181415609 22:22756600-22756622 CCATCTCAGAGTCTGCTTCCAGG + Intronic
1181765357 22:25087672-25087694 CCACCTCAGAGTCTGCTTCTGGG - Intronic
1182005991 22:26960172-26960194 CCATCTCAGAATCTGTTTCCTGG - Intergenic
1203283753 22_KI270734v1_random:144519-144541 CCACCTAAGGGGCTCTTTCCTGG + Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
950938325 3:16866249-16866271 CCATCTCAGAGTCAGTTTCCTGG + Intronic
951031420 3:17885978-17886000 CCATCTCAGAGTCTGTTTTCAGG - Intronic
952313867 3:32215387-32215409 CCACCTTGGGGACAGTTGCCTGG - Intergenic
953538782 3:43796133-43796155 CCATCTCAGAGTCTGGTTCCTGG - Intergenic
953691137 3:45120702-45120724 CCACCTTAGTCACTGTGTTCAGG + Intronic
957274304 3:78070549-78070571 CCAACTGAAATACTGTTTCCTGG + Intergenic
960574846 3:119219295-119219317 CCAGCTCAGAGTCTGTTTCCTGG + Intronic
961376715 3:126471618-126471640 CAACCCTGGAGACTGTGTCCAGG - Intronic
961583056 3:127899170-127899192 CAGCCTCAGAGCCTGTTTCCTGG - Intergenic
961973001 3:130990117-130990139 CTACCATAAAGACTGTTCCCTGG - Intronic
962686400 3:137852239-137852261 CCACCTCACAGAGTGCTTCCAGG - Intergenic
962724468 3:138209082-138209104 ACCCCTTACAGACTGTTTCATGG + Intronic
963231230 3:142910503-142910525 CCATCTCAAAGTCTGTTTCCAGG + Intergenic
963770768 3:149384081-149384103 CCACCTTACACACAGCTTCCTGG + Intergenic
965342746 3:167510716-167510738 ACACCTAAGAGTCTCTTTCCAGG - Intronic
966098804 3:176241718-176241740 CCATCTCAGAGACTATTTGCTGG - Intergenic
970073672 4:12194103-12194125 CCATCTCAGAGTCTGCTTCCAGG - Intergenic
973334408 4:48941852-48941874 CCATCTCGGAGTCTGTTTCCAGG - Intergenic
975756720 4:77578603-77578625 CCACCTCACAGATTGATTCCAGG - Intronic
976131130 4:81885046-81885068 CCATCTTACAGTCTGTTTCCTGG - Intronic
976349984 4:84050358-84050380 CCAACTAAGACAGTGTTTCCTGG - Intergenic
980606959 4:135104986-135105008 TCACCTCAGAGTCTGATTCCTGG - Intergenic
981456885 4:144962737-144962759 CCACCTCACAGATTGATTCCAGG - Intergenic
982420190 4:155185625-155185647 CTACCTTAGAGATTTTCTCCAGG - Intergenic
985772287 5:1820424-1820446 CCACCTTAGAGATTGCAGCCGGG - Intergenic
987524517 5:19030400-19030422 CCACCTTCGGGACTGTGCCCAGG - Intergenic
987829090 5:23073368-23073390 CCATCTCAGAGTCTATTTCCAGG - Intergenic
990647292 5:57858781-57858803 CCATCTCAGAGTCTGCTTCCTGG - Intergenic
992021755 5:72631875-72631897 CCACCTCAGAGTCTGCTTCCTGG - Intergenic
992363706 5:76070025-76070047 TGACCTGAGAGACAGTTTCCAGG - Intergenic
992766997 5:80010605-80010627 CCATCTCAGAGTCTGTTTCCTGG - Intronic
994055126 5:95406180-95406202 CCATCTCAGAGTCTGTTCCCTGG - Intronic
994665387 5:102698425-102698447 CCACCTTTGAGTTTATTTCCTGG - Intergenic
995205382 5:109473814-109473836 CAACTTTAGAGACTGTTTACTGG + Intergenic
997155160 5:131548395-131548417 GCACAAGAGAGACTGTTTCCTGG - Intronic
998646024 5:144063406-144063428 CCACCTTGGAGACAGTTCTCAGG - Intergenic
1000414581 5:160970123-160970145 CCCTCTCAGAGTCTGTTTCCCGG + Intergenic
1001328356 5:170745472-170745494 CCACCTAAGAGGCTGTCCCCTGG + Intergenic
1002291127 5:178201622-178201644 CCACATTGGGGATTGTTTCCAGG - Intergenic
1006916135 6:37595001-37595023 CTGCCTCAGAGATTGTTTCCAGG - Intergenic
1007034882 6:38664082-38664104 CCATCTTGAAGCCTGTTTCCTGG + Intergenic
1008164298 6:48117122-48117144 CTGTCTCAGAGACTGTTTCCAGG - Intergenic
1008701501 6:54106031-54106053 CCATCTCAGAGCCTGCTTCCTGG - Intronic
1010441216 6:75896868-75896890 TCACCTTAGACACTGATTGCGGG - Intronic
1010545370 6:77148836-77148858 CCATCTTAGAGACTATGTCTAGG + Intergenic
1010618399 6:78042333-78042355 ACATCTTAGAGTCTGTTTACAGG - Intergenic
1011223396 6:85081634-85081656 CCATCTTAGAGTCTGTTTCTTGG + Intergenic
1011508257 6:88071939-88071961 CCAACTTACAGGCAGTTTCCAGG + Intergenic
1012275830 6:97274581-97274603 CCCACCTAGAGACAGTTTCCAGG + Intronic
1015216950 6:130761352-130761374 CCACCATAAAGAATTTTTCCAGG - Intergenic
1015800139 6:137052275-137052297 CTACCTCAGAGTCTGCTTCCTGG + Intergenic
1016987616 6:149906822-149906844 CCATCTTAGAGACTCCTTCTGGG - Intergenic
1017663431 6:156695844-156695866 CCAGCTCAGAGTCTGTTTCCAGG + Intergenic
1019308384 7:347096-347118 CCACCCTAGAGGGTGTTTCTGGG - Intergenic
1020623406 7:10546270-10546292 CCACCTCAGAGAGGTTTTCCAGG + Intergenic
1025604286 7:63028205-63028227 CCATCTTAGCGTCTGTTTCTGGG - Intergenic
1028947888 7:96601494-96601516 CCACCTTAGAGACTGGGCACTGG - Intronic
1030041352 7:105453165-105453187 CCACCTCACAGATTGATTCCAGG - Intronic
1030680637 7:112430360-112430382 CCACCTTCCAGATTGTTGCCAGG - Intronic
1031414246 7:121476704-121476726 GCTCCTTAGAGACCCTTTCCAGG + Intergenic
1033490916 7:141842656-141842678 CCACCATAGACACTCATTCCTGG - Intergenic
1033985619 7:147222327-147222349 CCAGCTCAGAGAATTTTTCCTGG + Intronic
1034140998 7:148816202-148816224 TCACCTTAGCGAATGTTTTCAGG - Intronic
1034927911 7:155138118-155138140 TCATCTCAGAGTCTGTTTCCTGG - Intergenic
1035058165 7:156050647-156050669 CCACCTCACAGGCTGCTTCCAGG - Intergenic
1035078059 7:156194050-156194072 CCATCTCAGAGTCTGTTTCCTGG - Intergenic
1035314703 7:157990672-157990694 CAACATGAGAGGCTGTTTCCTGG - Intronic
1042059925 8:64805458-64805480 CCCTCTCAGAGTCTGTTTCCTGG - Intergenic
1042250303 8:66749914-66749936 ACACCCTAGAAACTATTTCCAGG - Intronic
1042442307 8:68842726-68842748 CCACCTCACAGATTGATTCCAGG + Intergenic
1042449882 8:68932088-68932110 CCACCCTAGAGAGAATTTCCTGG - Intergenic
1043513165 8:80970022-80970044 CATCCTTAGGCACTGTTTCCTGG + Exonic
1043804871 8:84659150-84659172 CCATCTCAGTGTCTGTTTCCTGG - Intronic
1043966330 8:86481824-86481846 CCAACTAACACACTGTTTCCTGG - Intronic
1045785956 8:105920528-105920550 CAATCTTAGAGAATGTTTCAAGG - Intergenic
1046175196 8:110566518-110566540 CCATCCCAGAGACTCTTTCCAGG + Intergenic
1046263275 8:111798875-111798897 CCTTCTTAGAGTCTGTTTCCTGG + Intergenic
1046962702 8:120126690-120126712 CCAGCTTAAAGCCTGTTTGCTGG - Intronic
1047092965 8:121593848-121593870 CCATCTCAGGGTCTGTTTCCTGG + Intergenic
1048378561 8:133844340-133844362 CCACCTTAGAGACTGTTTCCTGG - Intergenic
1048477621 8:134757381-134757403 CCAGCTAAGAGTCTGTTTGCAGG + Intergenic
1049104215 8:140601302-140601324 CCTCCTTAGAGACTGCTGACTGG + Intronic
1051560611 9:18436816-18436838 CCACCTCAGAGTCTGCTTCCAGG - Intergenic
1057864513 9:98668214-98668236 CCATCTCAGAGTCTTTTTCCTGG + Intronic
1058647439 9:107143599-107143621 CTACCTCAGAGGTTGTTTCCAGG - Intergenic
1058890184 9:109354692-109354714 CCATCTCAGAGGCTATTTCCAGG + Intergenic
1059946752 9:119417010-119417032 GCACCTCTGAGCCTGTTTCCTGG - Intergenic
1061832268 9:133303705-133303727 CCACCCCAGAGACGGCTTCCCGG + Intergenic
1061876873 9:133548473-133548495 CCACCTCAGAGTCTATTTTCTGG - Intronic
1062070932 9:134554635-134554657 CCACCTTAGGGCTTGTTTGCTGG - Intergenic
1189647895 X:43154070-43154092 CCACCTTAGAGTCTATTTCCAGG + Intergenic
1189656191 X:43247306-43247328 CCATCTCAGAATCTGTTTCCTGG + Intergenic
1189704576 X:43747298-43747320 GTATCTTAGAGTCTGTTTCCAGG - Intergenic
1190113359 X:47609548-47609570 CCACCTCAAAGTCTTTTTCCAGG + Intronic
1198397178 X:136231816-136231838 TCACCTTGGGAACTGTTTCCAGG + Exonic
1201075717 Y:10185915-10185937 CCACCCTAGACACCGTTTACGGG + Intergenic