ID: 1048380532

View in Genome Browser
Species Human (GRCh38)
Location 8:133861337-133861359
Sequence TGGATTGTTTTAGTAGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048380532_1048380538 -2 Left 1048380532 8:133861337-133861359 CCCATCTCTACTAAAACAATCCA No data
Right 1048380538 8:133861358-133861380 CAAAAATTAGCTGGGCATGGTGG 0: 22180
1: 66270
2: 133935
3: 178969
4: 181051
1048380532_1048380536 -5 Left 1048380532 8:133861337-133861359 CCCATCTCTACTAAAACAATCCA No data
Right 1048380536 8:133861355-133861377 ATCCAAAAATTAGCTGGGCATGG 0: 73
1: 23204
2: 54484
3: 105848
4: 138525
1048380532_1048380535 -10 Left 1048380532 8:133861337-133861359 CCCATCTCTACTAAAACAATCCA No data
Right 1048380535 8:133861350-133861372 AAACAATCCAAAAATTAGCTGGG No data
1048380532_1048380541 25 Left 1048380532 8:133861337-133861359 CCCATCTCTACTAAAACAATCCA No data
Right 1048380541 8:133861385-133861407 ATCTGTAATCCCAGCTACTTGGG 0: 1108
1: 21646
2: 111801
3: 249750
4: 354522
1048380532_1048380543 29 Left 1048380532 8:133861337-133861359 CCCATCTCTACTAAAACAATCCA No data
Right 1048380543 8:133861389-133861411 GTAATCCCAGCTACTTGGGAGGG 0: 598
1: 1941
2: 3630
3: 6981
4: 7529
1048380532_1048380540 24 Left 1048380532 8:133861337-133861359 CCCATCTCTACTAAAACAATCCA No data
Right 1048380540 8:133861384-133861406 CATCTGTAATCCCAGCTACTTGG 0: 1968
1: 32278
2: 83985
3: 175623
4: 233398
1048380532_1048380539 1 Left 1048380532 8:133861337-133861359 CCCATCTCTACTAAAACAATCCA No data
Right 1048380539 8:133861361-133861383 AAATTAGCTGGGCATGGTGGTGG 0: 8563
1: 27056
2: 52417
3: 58800
4: 36234
1048380532_1048380542 28 Left 1048380532 8:133861337-133861359 CCCATCTCTACTAAAACAATCCA No data
Right 1048380542 8:133861388-133861410 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048380532 Original CRISPR TGGATTGTTTTAGTAGAGAT GGG (reversed) Intergenic
No off target data available for this crispr