ID: 1048383757

View in Genome Browser
Species Human (GRCh38)
Location 8:133892326-133892348
Sequence CATCTGTTGTTGGGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048383751_1048383757 6 Left 1048383751 8:133892297-133892319 CCTTCCTGATGATACACCATCTT No data
Right 1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG No data
1048383752_1048383757 2 Left 1048383752 8:133892301-133892323 CCTGATGATACACCATCTTTCAT No data
Right 1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG No data
1048383750_1048383757 14 Left 1048383750 8:133892289-133892311 CCTCAGCACCTTCCTGATGATAC No data
Right 1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG No data
1048383753_1048383757 -10 Left 1048383753 8:133892313-133892335 CCATCTTTCATGACATCTGTTGT No data
Right 1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048383757 Original CRISPR CATCTGTTGTTGGGGAAAAA AGG Intergenic
No off target data available for this crispr