ID: 1048384650

View in Genome Browser
Species Human (GRCh38)
Location 8:133900901-133900923
Sequence GAGCCTAAGCAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048384650_1048384655 10 Left 1048384650 8:133900901-133900923 CCCTCCTCACTCTGCTTAGGCTC No data
Right 1048384655 8:133900934-133900956 TGCCAAACCACTGCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048384650 Original CRISPR GAGCCTAAGCAGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr