ID: 1048384655

View in Genome Browser
Species Human (GRCh38)
Location 8:133900934-133900956
Sequence TGCCAAACCACTGCCCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048384650_1048384655 10 Left 1048384650 8:133900901-133900923 CCCTCCTCACTCTGCTTAGGCTC No data
Right 1048384655 8:133900934-133900956 TGCCAAACCACTGCCCTCTGTGG No data
1048384647_1048384655 30 Left 1048384647 8:133900881-133900903 CCCTCTCTCTTGTGCAGGTGCCC No data
Right 1048384655 8:133900934-133900956 TGCCAAACCACTGCCCTCTGTGG No data
1048384652_1048384655 6 Left 1048384652 8:133900905-133900927 CCTCACTCTGCTTAGGCTCTGAA No data
Right 1048384655 8:133900934-133900956 TGCCAAACCACTGCCCTCTGTGG No data
1048384648_1048384655 29 Left 1048384648 8:133900882-133900904 CCTCTCTCTTGTGCAGGTGCCCT No data
Right 1048384655 8:133900934-133900956 TGCCAAACCACTGCCCTCTGTGG No data
1048384651_1048384655 9 Left 1048384651 8:133900902-133900924 CCTCCTCACTCTGCTTAGGCTCT No data
Right 1048384655 8:133900934-133900956 TGCCAAACCACTGCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048384655 Original CRISPR TGCCAAACCACTGCCCTCTG TGG Intergenic
No off target data available for this crispr