ID: 1048388157

View in Genome Browser
Species Human (GRCh38)
Location 8:133933021-133933043
Sequence CACACCTAACACTCAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048388157_1048388162 11 Left 1048388157 8:133933021-133933043 CCAAGATCTGAGTGTTAGGTGTG No data
Right 1048388162 8:133933055-133933077 GGGGCAGGTGTCATGTTTCTAGG No data
1048388157_1048388163 23 Left 1048388157 8:133933021-133933043 CCAAGATCTGAGTGTTAGGTGTG No data
Right 1048388163 8:133933067-133933089 ATGTTTCTAGGCCTTCTCAGAGG No data
1048388157_1048388158 -10 Left 1048388157 8:133933021-133933043 CCAAGATCTGAGTGTTAGGTGTG No data
Right 1048388158 8:133933034-133933056 GTTAGGTGTGCTTGTTATACTGG No data
1048388157_1048388161 -4 Left 1048388157 8:133933021-133933043 CCAAGATCTGAGTGTTAGGTGTG No data
Right 1048388161 8:133933040-133933062 TGTGCTTGTTATACTGGGGCAGG No data
1048388157_1048388160 -8 Left 1048388157 8:133933021-133933043 CCAAGATCTGAGTGTTAGGTGTG No data
Right 1048388160 8:133933036-133933058 TAGGTGTGCTTGTTATACTGGGG No data
1048388157_1048388159 -9 Left 1048388157 8:133933021-133933043 CCAAGATCTGAGTGTTAGGTGTG No data
Right 1048388159 8:133933035-133933057 TTAGGTGTGCTTGTTATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048388157 Original CRISPR CACACCTAACACTCAGATCT TGG (reversed) Intergenic
No off target data available for this crispr