ID: 1048392797

View in Genome Browser
Species Human (GRCh38)
Location 8:133984165-133984187
Sequence ATTGATCACCAGTTCTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048392797_1048392799 0 Left 1048392797 8:133984165-133984187 CCCAAAGAGAACTGGTGATCAAT No data
Right 1048392799 8:133984188-133984210 GTAGACTTTACTAAAAGATGAGG No data
1048392797_1048392801 15 Left 1048392797 8:133984165-133984187 CCCAAAGAGAACTGGTGATCAAT No data
Right 1048392801 8:133984203-133984225 AGATGAGGAGATGAGAGTTAGGG No data
1048392797_1048392800 14 Left 1048392797 8:133984165-133984187 CCCAAAGAGAACTGGTGATCAAT No data
Right 1048392800 8:133984202-133984224 AAGATGAGGAGATGAGAGTTAGG No data
1048392797_1048392803 17 Left 1048392797 8:133984165-133984187 CCCAAAGAGAACTGGTGATCAAT No data
Right 1048392803 8:133984205-133984227 ATGAGGAGATGAGAGTTAGGGGG No data
1048392797_1048392802 16 Left 1048392797 8:133984165-133984187 CCCAAAGAGAACTGGTGATCAAT No data
Right 1048392802 8:133984204-133984226 GATGAGGAGATGAGAGTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048392797 Original CRISPR ATTGATCACCAGTTCTCTTT GGG (reversed) Intergenic
No off target data available for this crispr