ID: 1048402272

View in Genome Browser
Species Human (GRCh38)
Location 8:134083158-134083180
Sequence AAAACATACTAGACACTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048402272_1048402274 7 Left 1048402272 8:134083158-134083180 CCATACAGTGTCTAGTATGTTTT No data
Right 1048402274 8:134083188-134083210 GCTGCCAACCCTGTTTCACAGGG No data
1048402272_1048402273 6 Left 1048402272 8:134083158-134083180 CCATACAGTGTCTAGTATGTTTT No data
Right 1048402273 8:134083187-134083209 TGCTGCCAACCCTGTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048402272 Original CRISPR AAAACATACTAGACACTGTA TGG (reversed) Intergenic
No off target data available for this crispr