ID: 1048408673

View in Genome Browser
Species Human (GRCh38)
Location 8:134149452-134149474
Sequence TGTCATATCATGATCATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048408673_1048408674 12 Left 1048408673 8:134149452-134149474 CCTGGTATGATCATGATATGACA No data
Right 1048408674 8:134149487-134149509 TGAGAACAATCACTCTGTGAAGG No data
1048408673_1048408675 17 Left 1048408673 8:134149452-134149474 CCTGGTATGATCATGATATGACA No data
Right 1048408675 8:134149492-134149514 ACAATCACTCTGTGAAGGAAAGG No data
1048408673_1048408676 24 Left 1048408673 8:134149452-134149474 CCTGGTATGATCATGATATGACA No data
Right 1048408676 8:134149499-134149521 CTCTGTGAAGGAAAGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048408673 Original CRISPR TGTCATATCATGATCATACC AGG (reversed) Intergenic
No off target data available for this crispr