ID: 1048408676

View in Genome Browser
Species Human (GRCh38)
Location 8:134149499-134149521
Sequence CTCTGTGAAGGAAAGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048408673_1048408676 24 Left 1048408673 8:134149452-134149474 CCTGGTATGATCATGATATGACA No data
Right 1048408676 8:134149499-134149521 CTCTGTGAAGGAAAGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048408676 Original CRISPR CTCTGTGAAGGAAAGGTAGA TGG Intergenic
No off target data available for this crispr