ID: 1048409407

View in Genome Browser
Species Human (GRCh38)
Location 8:134156545-134156567
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048409407_1048409417 24 Left 1048409407 8:134156545-134156567 CCTTAGGCACGCCTTACCCACTC No data
Right 1048409417 8:134156592-134156614 CTTGTCGTCCTTCACCAGCCCGG No data
1048409407_1048409418 29 Left 1048409407 8:134156545-134156567 CCTTAGGCACGCCTTACCCACTC No data
Right 1048409418 8:134156597-134156619 CGTCCTTCACCAGCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048409407 Original CRISPR GAGTGGGTAAGGCGTGCCTA AGG (reversed) Intergenic
No off target data available for this crispr