ID: 1048412140

View in Genome Browser
Species Human (GRCh38)
Location 8:134186138-134186160
Sequence ATATCCCCCAAGGAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048412140_1048412145 6 Left 1048412140 8:134186138-134186160 CCCTCCCTCTCCTTGGGGGATAT No data
Right 1048412145 8:134186167-134186189 TTATACCTGCTTTACAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048412140 Original CRISPR ATATCCCCCAAGGAGAGGGA GGG (reversed) Intergenic
No off target data available for this crispr