ID: 1048413394

View in Genome Browser
Species Human (GRCh38)
Location 8:134199277-134199299
Sequence GGTTCCATTAGAGGCCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048413391_1048413394 20 Left 1048413391 8:134199234-134199256 CCAAAAAAAAAAAAAAAAAAAAA 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
Right 1048413394 8:134199277-134199299 GGTTCCATTAGAGGCCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048413394 Original CRISPR GGTTCCATTAGAGGCCAAGT TGG Intergenic
No off target data available for this crispr