ID: 1048420805

View in Genome Browser
Species Human (GRCh38)
Location 8:134276568-134276590
Sequence CCTGGCAAGCTGCTATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048420805_1048420809 10 Left 1048420805 8:134276568-134276590 CCTTCCAATAGCAGCTTGCCAGG No data
Right 1048420809 8:134276601-134276623 AATGTGATACATTATCTTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048420805 Original CRISPR CCTGGCAAGCTGCTATTGGA AGG (reversed) Intergenic
No off target data available for this crispr