ID: 1048423124

View in Genome Browser
Species Human (GRCh38)
Location 8:134296721-134296743
Sequence GAACCATGGTAGTCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048423124_1048423128 18 Left 1048423124 8:134296721-134296743 CCAGAAACAGACTACCATGGTTC No data
Right 1048423128 8:134296762-134296784 CCATCAACTATGTGACGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048423124 Original CRISPR GAACCATGGTAGTCTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr