ID: 1048426979

View in Genome Browser
Species Human (GRCh38)
Location 8:134332154-134332176
Sequence CTTTGGCAGTGGAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048426979_1048426989 28 Left 1048426979 8:134332154-134332176 CCACCCACTTTCCACTGCCAAAG No data
Right 1048426989 8:134332205-134332227 TATTCAGGAGAGGAAGTGATGGG No data
1048426979_1048426985 -3 Left 1048426979 8:134332154-134332176 CCACCCACTTTCCACTGCCAAAG No data
Right 1048426985 8:134332174-134332196 AAGTAAAAAGAAGACTCAGGTGG No data
1048426979_1048426987 18 Left 1048426979 8:134332154-134332176 CCACCCACTTTCCACTGCCAAAG No data
Right 1048426987 8:134332195-134332217 GGTACAATGTTATTCAGGAGAGG No data
1048426979_1048426984 -6 Left 1048426979 8:134332154-134332176 CCACCCACTTTCCACTGCCAAAG No data
Right 1048426984 8:134332171-134332193 CCAAAGTAAAAAGAAGACTCAGG No data
1048426979_1048426988 27 Left 1048426979 8:134332154-134332176 CCACCCACTTTCCACTGCCAAAG No data
Right 1048426988 8:134332204-134332226 TTATTCAGGAGAGGAAGTGATGG No data
1048426979_1048426986 13 Left 1048426979 8:134332154-134332176 CCACCCACTTTCCACTGCCAAAG No data
Right 1048426986 8:134332190-134332212 CAGGTGGTACAATGTTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048426979 Original CRISPR CTTTGGCAGTGGAAAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr