ID: 1048427546

View in Genome Browser
Species Human (GRCh38)
Location 8:134336807-134336829
Sequence AGGAGCAAGGGTGTGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048427546_1048427557 9 Left 1048427546 8:134336807-134336829 CCACCTGCCACACCCTTGCTCCT No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427546_1048427551 -6 Left 1048427546 8:134336807-134336829 CCACCTGCCACACCCTTGCTCCT No data
Right 1048427551 8:134336824-134336846 GCTCCTTGTGTCTCCCCAGATGG No data
1048427546_1048427552 -5 Left 1048427546 8:134336807-134336829 CCACCTGCCACACCCTTGCTCCT No data
Right 1048427552 8:134336825-134336847 CTCCTTGTGTCTCCCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048427546 Original CRISPR AGGAGCAAGGGTGTGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr