ID: 1048427548

View in Genome Browser
Species Human (GRCh38)
Location 8:134336814-134336836
Sequence AGACACAAGGAGCAAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048427548_1048427557 2 Left 1048427548 8:134336814-134336836 CCACACCCTTGCTCCTTGTGTCT No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427548_1048427560 25 Left 1048427548 8:134336814-134336836 CCACACCCTTGCTCCTTGTGTCT No data
Right 1048427560 8:134336862-134336884 CCTTATGATTCCTGAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048427548 Original CRISPR AGACACAAGGAGCAAGGGTG TGG (reversed) Intergenic
No off target data available for this crispr