ID: 1048427549

View in Genome Browser
Species Human (GRCh38)
Location 8:134336819-134336841
Sequence TGGGGAGACACAAGGAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048427549_1048427560 20 Left 1048427549 8:134336819-134336841 CCCTTGCTCCTTGTGTCTCCCCA No data
Right 1048427560 8:134336862-134336884 CCTTATGATTCCTGAATTCCAGG No data
1048427549_1048427557 -3 Left 1048427549 8:134336819-134336841 CCCTTGCTCCTTGTGTCTCCCCA No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427549_1048427562 30 Left 1048427549 8:134336819-134336841 CCCTTGCTCCTTGTGTCTCCCCA No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048427549 Original CRISPR TGGGGAGACACAAGGAGCAA GGG (reversed) Intergenic
No off target data available for this crispr