ID: 1048427552

View in Genome Browser
Species Human (GRCh38)
Location 8:134336825-134336847
Sequence CTCCTTGTGTCTCCCCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048427544_1048427552 5 Left 1048427544 8:134336797-134336819 CCCAAATAGGCCACCTGCCACAC No data
Right 1048427552 8:134336825-134336847 CTCCTTGTGTCTCCCCAGATGGG No data
1048427547_1048427552 -8 Left 1048427547 8:134336810-134336832 CCTGCCACACCCTTGCTCCTTGT No data
Right 1048427552 8:134336825-134336847 CTCCTTGTGTCTCCCCAGATGGG No data
1048427545_1048427552 4 Left 1048427545 8:134336798-134336820 CCAAATAGGCCACCTGCCACACC No data
Right 1048427552 8:134336825-134336847 CTCCTTGTGTCTCCCCAGATGGG No data
1048427541_1048427552 16 Left 1048427541 8:134336786-134336808 CCTTCCCTACTCCCAAATAGGCC No data
Right 1048427552 8:134336825-134336847 CTCCTTGTGTCTCCCCAGATGGG No data
1048427546_1048427552 -5 Left 1048427546 8:134336807-134336829 CCACCTGCCACACCCTTGCTCCT No data
Right 1048427552 8:134336825-134336847 CTCCTTGTGTCTCCCCAGATGGG No data
1048427543_1048427552 11 Left 1048427543 8:134336791-134336813 CCTACTCCCAAATAGGCCACCTG No data
Right 1048427552 8:134336825-134336847 CTCCTTGTGTCTCCCCAGATGGG No data
1048427542_1048427552 12 Left 1048427542 8:134336790-134336812 CCCTACTCCCAAATAGGCCACCT No data
Right 1048427552 8:134336825-134336847 CTCCTTGTGTCTCCCCAGATGGG No data
1048427539_1048427552 21 Left 1048427539 8:134336781-134336803 CCTCTCCTTCCCTACTCCCAAAT No data
Right 1048427552 8:134336825-134336847 CTCCTTGTGTCTCCCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048427552 Original CRISPR CTCCTTGTGTCTCCCCAGAT GGG Intergenic
No off target data available for this crispr