ID: 1048427553

View in Genome Browser
Species Human (GRCh38)
Location 8:134336827-134336849
Sequence ATCCCATCTGGGGAGACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048427553_1048427560 12 Left 1048427553 8:134336827-134336849 CCTTGTGTCTCCCCAGATGGGAT No data
Right 1048427560 8:134336862-134336884 CCTTATGATTCCTGAATTCCAGG No data
1048427553_1048427562 22 Left 1048427553 8:134336827-134336849 CCTTGTGTCTCCCCAGATGGGAT No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048427553 Original CRISPR ATCCCATCTGGGGAGACACA AGG (reversed) Intergenic
No off target data available for this crispr