ID: 1048427554

View in Genome Browser
Species Human (GRCh38)
Location 8:134336837-134336859
Sequence TGGTGTGTGAATCCCATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048427554_1048427562 12 Left 1048427554 8:134336837-134336859 CCCCAGATGGGATTCACACACCA No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data
1048427554_1048427560 2 Left 1048427554 8:134336837-134336859 CCCCAGATGGGATTCACACACCA No data
Right 1048427560 8:134336862-134336884 CCTTATGATTCCTGAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048427554 Original CRISPR TGGTGTGTGAATCCCATCTG GGG (reversed) Intergenic
No off target data available for this crispr