ID: 1048427555

View in Genome Browser
Species Human (GRCh38)
Location 8:134336838-134336860
Sequence CTGGTGTGTGAATCCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048427555_1048427560 1 Left 1048427555 8:134336838-134336860 CCCAGATGGGATTCACACACCAG No data
Right 1048427560 8:134336862-134336884 CCTTATGATTCCTGAATTCCAGG No data
1048427555_1048427562 11 Left 1048427555 8:134336838-134336860 CCCAGATGGGATTCACACACCAG No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048427555 Original CRISPR CTGGTGTGTGAATCCCATCT GGG (reversed) Intergenic
No off target data available for this crispr